21.iv. Tetraphidopsida - lahosammalet. Takakiopsida
|
|
- Maija Karvonen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 21.iv. Bryophyta: Tetraphidopsida -- Bryopsida Tetraphidopsida - lahosammalet Takakiopsida
2 suuvaruksessa vain 4 suurta hammasta, muodostuneet kokonaisista soluista Tetraphis pellucida lahopuulla Tetrodontium brownianum kallioilla Bryopsida DEEP MOSS phylogeny of the oldest moss lineages Takakiopsida
3 Bell et al. BMC Genomics 2014, 15:383 RESEARCH ARTICLE Open Access Organellar genomes of the four-toothed moss, Tetraphis pellucida Neil E Bell 1,2*, Jeffrey L Boore 3, Brent D Mishler 4 and Jaakko Hyvönen 2 Abstract Background: Mosses are the largest of the three extant clades of gametophyte-dominant land plants and remain poorly studied using comparative genomic methods. Major monophyletic moss lineages are characterised by different types of a spore dehiscence apparatus called the peristome, and the most important unsolved problem in higher-level moss systematics is the branching order of these peristomate clades. Organellar genome sequencing offers the potential to resolve this issue through the provision of both genomic structural characters and a greatly increased quantity of nucleotide substitution characters, as well as to elucidate organellar evolution in mosses. We publish and describe the chloroplast and mitochondrial genomes of Tetraphis pellucida, representative of the most phylogenetically intractable and morphologically isolated peristomate lineage. Results: Assembly of reads from Illumina SBS and Pacific Biosciences RS sequencing reveals that the Tetraphis chloroplast genome comprises 127,489 bp and the mitochondrial genome 107,730 bp. Although genomic structures are similar to those of the small number of other known moss organellar genomes, the chloroplast lacks the petn gene (in common with Tortula ruralis) and the mitochondrion has only a non-functional pseudogenised remnant of nad7 (uniquely amongst known moss chondromes). Conclusions: Structural genomic features exist with the potential to be informative for phylogenetic relationships amongst the peristomate moss lineages, and thus organellar genome sequences are urgently required for exemplars from other clades. The unique genomic and morphological features of Tetraphis confirm its importance for resolving one of the major questions in land plant phylogeny and for understanding the evolution of the peristome, a likely key innovation underlying the diversity of mosses. The functional loss of nad7 from the chondrome is now shown to have occurred independently in all three bryophyte clades as well as in the early-diverging tracheophyte Huperzia squarrosa. Keywords: Moss, Tetraphis pellucida, Peristome, nad7, petn, Phylogeny, Organellar genomes, Sequencing Background Land plants (embryophytes) comprise three extant gametophyte-dominant clades (mosses, liverworts and hornworts) and one extant sporophyte-dominant clade (tracheophytes). The former comprise a paraphyletic grade known as the bryophytes, a morphological grouping of convenience that includes all lineages in which the diploid generation (the sporophyte) is unbranched, has only a single sporangium, and remains attached to a generally * Correspondence: neil.bell@helsinki.fi 1 Botanical Museum, Finnish Museum of Natural History, University of Helsinki, PO Box 7, FI Helsinki, Finland 2 Plant Biology, Department of Biosciences, University of Helsinki, PO Box 65, FI Helsinki, Finland Full list of author information is available at the end of the article more complex, well-developed, and persistent haploid generation (the gametophyte). Compared to the tracheophytes, there has been very little study of the organellar genomes of bryophytes. More genomic data are needed from representatives of each major clade, to solidify phylogenetic understanding as well as to investigate organellar evolution within the group. A key phylogenetic question that genomic data may be able to contribute towards solving is the branching order of the major peristomate clades (the peristome is the collective term for the elaborate teeth around the mouth of the capsule that provide a mechanism to control spore release). Sampling from the more isolated and morphologically distinct lineages surviving from this relatively early diversification event may also be an 2014 Bell et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated. Bryopsida Takakiopsida kuolleiden solujen seinien jäänteistä muodostuneet suuvaruksen hampaat arthrodontous peristome nivelikäs suuvarus
4 Sean Edwards Bryopsida kuolleiden solujen seinien jäänteistä muodostuneet suuvaruksen hampaat Takakiopsida arthrodontous peristome nivelikäs suuvarus
5 Buxbaumiidae - kaviosammalet Funariidae Bryidae
6 Sean Edwards Amfitekium Endotekium OPL outer peristome layer uloin solukerros IPL inner peristome layer sisin solukerros PPL primary peristome layer keskimmäinen solukerros kaavakuvissa 1/8 kokonaisesta suuvaruksesta
7 Timmia 4:2:8 OPL outer peristome layer uloin solukerros PPL primary peristome layer keskimmäinen solukerros IPL inner peristome layer sisin solukerros Funariidae - nuotiosammalet ~25 sukua pienikokoisia pioneerilajeja Physcomitrella patens
8 Dicranidae - kynsisammalet ~20 heimoa Dicranaceae, Ditrichaceae, Grimmiaceae, Pottiaceae Proctor, M.C.F. ym Desiccation-tolerance in bryophytes: a review. Bryologist 110: Sean Edwards
9 suuvarus haplolepidinen peristome haplolepidous joskus ulkoisesta suuvaruksesta merkkejä 4:2:3 Bryidae - hiirensammalet selkeästi SUURIN lehtisammalten ryhmä myös ekologisesti tärkein
10 suuvarus kaksinkertainen suuvarus diplolepidinen vuorottainen peristome diplolepidous alternate Sean Edwards
11 J. Enroth Hylocomium splendens lahkot Hypnodendrales, Ptychomniales, Hookeriales & Hypnales pleurokarppisia eli arkegoniot sivuhaaroilla LaFarge-England, C Growth form, branching pattern, and perichaetial position in mosses: cladocarpy and pleurocarpy redefined. Bryologist 99: HUOM! akrokarppinen ja pleurokarppinen viittaavat vain siihen missä munapesäkkeet ja sporofyytit sijaitsevat EIVÄT siihen onko sammal pysty vai kasvualustansa myötäinen Pleurozium schreberi
12 Lehtisammalten suvuton lisääntyminen n % lhsammalista suvuttomaan lisääntymiseen erikoistuneita rakenteita tällaisista lajeista n. 3/4 on dioikkisia irtoavia haaroja, lehtiä Pohlia, lh hangoissa redusoituneita haaroja Tetraphis erikoistuneiden lh muodostama ruusuke varren kärjessä, keskellä itujyväsiä itujyväsiä kehittyy lh kärkiin, laitoihin, ritsoidien ja protoneeman pinnalle, erikoistuneille lehdettömille haaroille (esim. Aulacomnium androgynum) Newton, A. E. ym Dating the diversification of the pleurocarpous mosses. Teoksessa: Newton, A.E. ym. (toim.) Pleurocarpous mosses: systematics and evolution, CRC Press by Taylor & Francis. Laenen, B. ym Bryophytes diversified slowly but surely since the mid-mesozoic. Nature Communications 5: 6134
13 Polysporangiophyta monipesäkkeelliset Lycophytina liekomaiset kasvit Euphyllophytina lehdelliset kasvit sporofyytin ilmaraot munapesäke sekovarren solukkojen ympäröimä, EI siis pinnalla (superficial) Anthocerotophyta - sarvisammalet kiilamainen apikaalisolu pyrenoidi limasolut ~ 10 sukua, ~100 spp. pääosin paljaan mineraalimaan spp. ilmarakoja sekovarren alapinnalla syanobakteerisymbiontit anteridiot endogeenisiä siittiöiden rakenne Villarreal, J.C. ym A synthesis of hornwort diversity: patterns, causes and future directions. Phytotaxa 9: tsygootin 1. solunjakautuminen elateerit lisäksi useita DNAtason ominaisuuksia
14 Anthocerotophyta - sarvisammalet Polysporangiophyta moni-itiöpesäkkeelliset Lycophytina liekomaiset kasvit Euphyllophytina lehdelliset kasvit Anthocerotophyta - sarvisammalet Polysporangiophyta monipesäkkeelliset Lycophytina liekomaiset kasvit Euphyllophytina lehdelliset kasvit
15 4 : 1 itiöt: elateerit itiön emosolu meioosi 4 itiötä itiön/elateerin emosolu 1. mitoosi Marchantiopsida (eräät lajit) Dendroceros (Anthocerotophyta) elateerin emosolu 1 elateeri 8+ : 1 itiöt: elateerit itiön/elateerin emosolu 1. mitoosi itiön emosolu >1 mitooseja, meioosi 8, 16, 32 itiötä Marchantiophyta elateerin emosolu 1 elateeri 1 : 1+ itiöt: elateerit itiön emosolu meioosi 4 itiötä itiön/elateerin emosolu Anthocerotophyta 1. mitoosi elateerin emosolu >2 mitooseja 4, 6, 8 elateeria Sarvisammalten suvuton lisääntyminen itujyväsiä voi kehittyä sekovarren ala- (lepojyväset, tubers) ja yläpinnalle sekä reunoihin pitkulaisia, jopa haaraisia lisäkkeitä sekovarren alapinnalla Villarreal, J.C. & Renner, S.S Hornwort pyrenoids, carbon-concentrating structures, evolved and were lost at least five times during the last 100 million years. PNAS 109:
16 YHTEENVETO lehtisammalten runsaslajisimmassa luokassa (Bryopsida) erikoistunein suuvaruksen rakenne lehtisammalia esiintyy HYVIN erilaisissa ympäristöissä - autiomaista järviin ja jokiin lehtisammalet ekologisesti tärkeitä arktisessa & boreaalisessa vyöhykkeessä sekä trooppisissa vuoristoissa Proctor, M.C.F Mosses and alternative adaptation to life on land. New Phytologist 148: 1-3. sarvisammalet pienin sammalryhmä, oletettavasti monipesäkkeellisten sisarryhmä myös sarvisammalten nykyinen monimuotoisuus syntynyt suurelta osin vasta liitu-tertiäärikauden aikana ENSIMMÄISET MERKIT ELÄMÄSTÄ MAALLA sammalet eivät merkittäviä ITIÖSATEEN muodostajina kaikissa sammalryhmissä: hedelmöittyminen --> 1 sporofyytti, jolla vain 1 sporangio Archidium (Dicranidae) 4-28(-176) itiötä/pesäke Grimmia (Dicranidae) itiötä/pesäke Dawsonia (Polytrichopsida) itiötä/pesäke monipesäkkeellisillä (polysporangiofyyteillä) 1 tsygootista pitkäikäinen sporofyytti, klonaalinen kasvu, useita sporangioita usean vuoden ajan POLYSPORANGIOFYYTIT kasveja joilla yhdellä sporofyytillä on useampia itiöpesäkkeitä eli SPORANGIOITA FOSSIILIAINEISTOA ---> eri kehityslinjojen minimi-ikä
ALKIOLLISET KASVIT. 18.iv. MAKSASAMMALET menestystä pienoiskoossa. Marchantiophyta - maksasammalet. sammalet. Polysporangiophyta monipesäkkeelliset
18.iv. MAKSASAMMALET menestystä pienoiskoossa Marchantiophyta - maksasammalet ALKIOLLISET KASVIT Polysporangiophyta monipesäkkeelliset Lycophytina liekomaiset kasvit Euphyllophytina lehdelliset kasvit
Lisätiedot19.iv. BRYOPHYTA - lehtisammalet. Bryophyta: Takakiopsida -- Polytrichopsida
19.iv. BRYOPHYTA - lehtisammalet Bryophyta: Takakiopsida -- Polytrichopsida ALKIOLLISET KASVIT Polysporangiophyta moni-itiöpesäkkeelliset Lycophytina liekokasvit Euphyllophytina lehdelliset kasvit periini
Lisätiedot15.iv. ALKIOLLISET KASVIT vedestä maalle. 2. vanhimmat fossiilit & ympäristö
15.iv. ALKIOLLISET KASVIT vedestä maalle 1. alkiolliset kasvit 2. vanhimmat fossiilit & ympäristö 3. sukupolvenvuorottelu 4. yhteenveto KASVIEN PÄÄRYHMÄT CHLOROPHYTA STREPTOPHYTA miksi juuri embryofyytit?
Lisätiedot1. Polysporangiophyta monipesäkkeelliset. 2. Tracheophyta putkisolulliset kasvit. Polysporangiophyta
22.iv. 1. Polysporangiophyta monipesäkkeelliset 2. Tracheophyta putkisolulliset kasvit 3. yhteenveto Polysporangiophyta Polysporangiophyta monipesäkkeelliset Lycophytina liekomaiset kasvit Euphyllophytina
LisätiedotFungi infecting cultivated moss can also cause diseases in crop plants
Fungi infecting cultivated moss can also cause diseases in crop plants SEMINAR ON PEST RISK ASSESSMENT 2-3 October 2012, Helsinki, Finland 9.10.2012 1 Fungi infecting cultivated moss can also cause diseases
Lisätiedot1. ritsomorfiset liekomaiset kasvit
25.iv. 1. ritsomorfiset liekomaiset kasvit 2. monilofyytit 3. kortemaiset kasvit 4. yhteenveto Lepidodendrales Isoetaceae lahnaruohot Selaginellaceae Lycopodiaceae mähkäkasvit liekokasvit LIGULA mikrofyllit
LisätiedotResults on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Lisätiedot14.iv. STREPTOPHYTA - vinosiimaiset
14.iv. STREPTOPHYTA - vinosiimaiset KASVIEN PÄÄRYHMÄT 2016 CHLOROPHYTA STREPTOPHYTA Turmel, M. ym. 2002. Mol. Biol. Evol. 19:24-38 Lemieux, C. ym. 2000: Ancestral chloroplast genome in Mesostigma viride
LisätiedotInfrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
LisätiedotKASVIKUNTA kl 2016
526128 KASVIKUNTA kl 2016 Luennot klo 10-12 salissa 6602 11.4. Ma johdanto kasvikuntaan 12.4. Ti Chlorophyta 14.4. To Streptophyta 15.4. Pe vanhimmat alkiolliset kasvit 18.4. Ma maksasammalet 19.4. Ti
LisätiedotCapacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Lisätiedot(monipesäkkeisiin) verrattuna pieniä ja rakenteeltaan yksinkertaisia. Tämän vuoksi konvergenttisen evoluution
K a s v i t i e t e e n p ä i v ä t 2 0 1 3 Lehtisammalten makromorfologia konvergenssia yksinkertaisissa alkiollisissa kasveissa Neil Bell ja Jaakko Hyvönen Lehtisammalet ovat pieniä, yksinkertaisia kasveja,
LisätiedotFETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Lisätiedot4.v. 1. Glossopteridales. 2. Bennettitales. 3. Caytonia. 4. koppisiemeniset. 5. yhteenveto MEDULLOSACEAE MAGNOLIOPSIDA
4.v. 1. Glossopteridales 2. Bennettitales 3. Caytonia 4. koppisiemeniset 5. yhteenveto Tetraxylopteris Archaeopteris Elkinsia Lyginopteris MEDULLOSACEAE L O S A C E A E Callistophyton CYCADACEAE ZAMIACEAE
LisätiedotAjettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
LisätiedotMALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
LisätiedotConstructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
LisätiedotNetwork to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
LisätiedotMUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotInformation on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
Lisätiedot3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ
Puhe ja kieli, 27:4, 141 147 (2007) 3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Soile Loukusa, Oulun yliopisto, suomen kielen, informaatiotutkimuksen ja logopedian laitos & University
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotInformation on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
LisätiedotInformation on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
LisätiedotRANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
LisätiedotTips for teachers and expected results
Tips for teachers and expected results Työskentely aloitetaan JOHDANNOLLA, jonka aikana annetaan tietoa vatsahappoihin liittyvistä ongelmista ja antasideista. Lisäksi esitetään kysymys, joka ohjaa oppilaiden
LisätiedotGap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
LisätiedotEfficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
LisätiedotMaster's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
LisätiedotExpression of interest
Expression of interest Avoin hakemus tohtorikoulutettavaksi käytäntö Miksi? Dear Ms. Terhi virkki-hatakka I am writing to introduce myself as a volunteer who have the eagerness to study in your university.
LisätiedotEQUISETALES - kortemaiset kasvit
13.5. 1. Equisetales 2. Marattiales 3. köykäispesäkkeiset saniaiset 4. yhteenveto EQUISETALES - kortemaiset kasvit 4 heimoa Calamitaceae Equisetac. Gondwanostachyac. Tchernoviac. Pseudoborniales Sphenophyllales
LisätiedotC++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
LisätiedotAYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
LisätiedotHeisingin kaupungin tietokeskus Helsingfors stads faktacentral City of Helsinki Urban Facts 0N THE EFFECTS 0F URBAN NATURAL AMENITIES, ARCHITECTURAL
Heisingin kaupungin tietokeskus - /igc' ^' 0N THE EFFECTS 0F URBAN NATURAL TIEOUSTELUT FÖRFÄGNINGAR INQUIRIES Henrik Lönnqvist, p. - tel. 09 310 36534 etunimi.sukunimi@hel.fi JULKAISIJA UTGIVARE PUBLISHER
LisätiedotEUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
LisätiedotOlet vastuussa osaamisestasi
Olet vastuussa osaamisestasi Ohjelmistoammattilaisuuden uudet haasteet Timo Vehmaro 02-12-2015 1 Nokia 2015 Mitä osaamista tulevaisuudessa tarvitaan? Vahva perusosaaminen on kaiken perusta Implementaatio
LisätiedotAccommodation statistics
Transport and Tourism 2011 Accommodation statistics 2011, January Nights spent by foreign tourists in Finland increased by per cent in January The number of recorded nights spent by foreign tourists at
LisätiedotJulkaisun laji Opinnäytetyö. Sivumäärä 43
OPINNÄYTETYÖN KUVAILULEHTI Tekijä(t) SUKUNIMI, Etunimi ISOVIITA, Ilari LEHTONEN, Joni PELTOKANGAS, Johanna Työn nimi Julkaisun laji Opinnäytetyö Sivumäärä 43 Luottamuksellisuus ( ) saakka Päivämäärä 12.08.2010
LisätiedotSalasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
LisätiedotThe CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
LisätiedotLUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10)
RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.
LisätiedotETELÄESPLANADI 2 00130 HELSINKI
00130 HELSINKI MODERNIA TOIMISTOTILAA Noin VUOKRATAAN Ainutlaatuinen tilaisuus vuokrata huipputason Helsingin näköalapaikalta Toimi pian! Lisätietoja KALLE JASKARA Myyntijohtaja +358 50 324 0404 kalle.jaskara@tkoy.fi
LisätiedotThe Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
Lisätiedot1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotKaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
LisätiedotIncrease of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
LisätiedotLYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
LisätiedotState of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
LisätiedotMineral raw materials Public R&D&I funding in Finland and Europe, 2015. Kari Keskinen
Mineral raw materials Public R&D&I funding in Finland and Europe, 2015 Kari Keskinen DM1369699 DM1369699 Green Mining (2011-2016) 81 projects started (39 company projects and 42 research projects) 117
LisätiedotOther approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
LisätiedotInformation on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
LisätiedotOP1. PreDP StudyPlan
OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize
LisätiedotFinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
LisätiedotLakimies PDF. ==>Download: Lakimies PDF ebook
Lakimies PDF ==>Download: Lakimies PDF ebook Lakimies PDF - Are you searching for Lakimies Books? Now, you will be happy that at this time Lakimies PDF is available at our online library. With our complete
LisätiedotSocial and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi
Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi Green Cities and Settlements 18.2.2014 Ville Manninen Writers Project group Sirpa Korhonen, Anna Mari
LisätiedotDigitalisoituminen, verkottuminen ja koulutuksen tulevaisuus. Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu
Digitalisoituminen, verkottuminen ja koulutuksen tulevaisuus Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu The future is already here - it is just unevenly distributed.
LisätiedotSkene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
LisätiedotThe Finnish healthcare service grid and access in rural Finland
The Finnish healthcare service grid and access in rural Finland Kimmo Parhiala, M.Soc.Sc Development Manager, National Institute for Health and Welfare TW: @parhialakimmo 20.6.2017 The Finnish healthcare
LisätiedotAlternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Lisätiedot1. Liikkuvat määreet
1. Liikkuvat määreet Väitelauseen perussanajärjestys: SPOTPA (subj. + pred. + obj. + tapa + paikka + aika) Suora sanajärjestys = subjekti on ennen predikaattia tekijä tekeminen Alasääntö 1: Liikkuvat määreet
LisätiedotPRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING
PRIMARY HPV TESTING IN ORGANIZED CERVICAL CANCER SCREENING Veijalainen O, Kares S, Kujala P, Vuento R, TirKkonen M, Kholová I, Osuala V, Mäenpää J University and University Hospital of Tampere, Finland,
LisätiedotMulti-drug use, polydrug use and problematic polydrug use in Finland in the light of the TDI data
Multi-drug use, polydrug use and problematic polydrug use in Finland in the light of the TDI data Martta Forsell, the Finnish Focal Point 26/11/2013 Martta Forsell 1 Primary drug (n= 2 688) Hypnotics,
LisätiedotNational Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
LisätiedotVATSAHAPPO JA NÄRÄSTYSLÄÄKKEET
VATSAHAPPO JA NÄRÄSTYSLÄÄKKEET Johdanto Ihmisen maha on luonnostaan melko hapan. Mahaneste koostuu pääasiassa suolahaposta ja sen konsentraatio on noin 0,01 mol/l. Näin hapan ympäristö on tarpeen proteiinien
LisätiedotLand-Use Model for the Helsinki Metropolitan Area
Land-Use Model for the Helsinki Metropolitan Area Paavo Moilanen Introduction & Background Metropolitan Area Council asked 2005: What is good land use for the transport systems plan? At first a literature
LisätiedotVerkkokauppatilasto 2014. Perustietoa verkkokauppaseurannasta sekä verkko-ostaminen 2014/H1
Verkkokauppatilasto 2014 Perustietoa verkkokauppaseurannasta sekä verkko-ostaminen 2014/H1 Verkkokauppatilasto Suomalaisen verkkokaupan arvo Verkkokauppatilasto sisältää kaiken verkkokauppaostamisen Kaikki
LisätiedotSmart specialisation for regions and international collaboration Smart Pilots Seminar
Smart specialisation for regions and international collaboration Smart Pilots Seminar 23.5.2017 Krista Taipale Head of Internaltional Affairs Helsinki-Uusimaa Regional Council Internationalisation
LisätiedotKONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
LisätiedotGeneral studies: Art and theory studies and language studies
General studies: Art and theory studies and language studies Centre for General Studies (YOYO) Aalto University School of Arts, Design and Architecture ARTS General Studies General Studies are offered
LisätiedotOstamisen muutos muutti myynnin. Technopolis Business Breakfast 21.8.2014
Ostamisen muutos muutti myynnin Technopolis Business Breakfast 21.8.2014 Taking Sales to a Higher Level Mercuri International on maailman suurin myynnin konsultointiyritys. Autamme asiakkaitamme parantamaan
LisätiedotThe BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region The BaltCICA Project is designed to focus on the most imminent problems that climate change is likely to cause
LisätiedotTietorakenteet ja algoritmit
Tietorakenteet ja algoritmit Taulukon edut Taulukon haitat Taulukon haittojen välttäminen Dynaamisesti linkattu lista Linkatun listan solmun määrittelytavat Lineaarisen listan toteutus dynaamisesti linkattuna
Lisätiedot16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
LisätiedotVAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
LisätiedotCollaborative & Co-Creative Design in the Semogen -projects
1 Collaborative & Co-Creative Design in the Semogen -projects Pekka Ranta Project Manager -research group, Intelligent Information Systems Laboratory 2 Semogen -project Supporting design of a machine system
LisätiedotOhjelmistoarkkitehtuurit Kevät 2016 Johdantoa
Ohjelmistoarkkitehtuurit Kevät 2016 Johdantoa Samuel Lahtinen http://www.cs.tut.fi/~ohar/ 8.1.2014 1 1 Johdanto 1.1 Mikä on ohjelmistoarkkitehtuuri? 1.2 Ohjelmistoarkkitehtuuri ja laatuvaatimukset 1.3
LisätiedotPricing policy: The Finnish experience
Pricing policy: The Finnish experience Esa Österberg Senior Researcher Alcohol and Drug Research, STAKES, Helsinki, Finland esa.osterberg@stakes.fi Three pillars of traditional Nordic alcohol control Strict
LisätiedotVäite Argument "Yhteiskunnan velvollisuus on tarjota virkistysalueita ja -palveluita." "Recreation sites and service
Olisiko vastaaja valmis maksamaan... Would the respondent be willing to pay for... Luonto-opastuksesta Nature guide services Autiotuvan käytöstä Use of wilderness huts Tulipaikan käytöstä (polttopuut,
LisätiedotFunctional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
LisätiedotYhtiön nimi: - Luotu: - Puhelin: - Fax: - Päiväys: -
Positio Laske Kuvaus 1 MAGNA 32-1 N Tuote No.: 98117 Huom.! Tuotteen kuva voi poiketa todellisesta tuotteesta The pump is of the canned rotor type, i.e. pump and motor form an integral unit without shaft
LisätiedotBasic Flute Technique
Herbert Lindholm Basic Flute Technique Peruskuviot huilulle op. 26 Helin & Sons, Helsinki Basic Flute Technique Foreword This book has the same goal as a teacher should have; to make himself unnecessary.
LisätiedotLataa SETI Revisited - Risto Isomäki. Lataa
Lataa SETI Revisited - Risto Isomäki Lataa Kirjailija: Risto Isomäki ISBN: 9789522648457 Sivumäärä: 100 Formaatti: PDF Tiedoston koko: 20.51 Mb In his newest book Risto Isomäki argues that instead of only
LisätiedotSupporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
LisätiedotStrategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University
LisätiedotSiirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools
Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools Akateemisten asioiden komitea Academic Affairs Committee 11 October 2016 Eija Zitting
LisätiedotHARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
LisätiedotSisällysluettelo Table of contents
Sisällysluettelo Table of contents OTC:n Moodlen käyttöohje suomeksi... 1 Kirjautuminen Moodleen... 2 Ensimmäinen kirjautuminen Moodleen... 2 Salasanan vaihto... 2 Oma käyttäjäprofiili... 3 Työskentely
LisätiedotKeuhkosammalen Marchantia polymorpha biologiaa ja ekologiaa: menestystarina vai katastrofi
Keuhkosammalen Marchantia polymorpha biologiaa ja ekologiaa: menestystarina vai katastrofi Sanna Laaka-Lindberg Kasvitieteen yksikkö, sammaltiimi Luonnontieteellinen keskusmuseo LUOMUS 1 2-2-2016 Keuhkosammal
LisätiedotMetsän pohjakerros. bi2. 8.10.2012 Mirjami Kaasinen ja Heidi Routama 8D
Metsän pohjakerros bi2 8.10.2012 Mirjami Kaasinen ja Heidi Routama 8D Summary We researched the ground layer of the forest (especially mosses and lichens) and made two different researches: the water absorption
Lisätiedot812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
LisätiedotNAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita
NAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita NAO-ENO työseminaari VI Tampere 3.-4.6.2015 Projektisuunnittelija Erno Hyvönen erno.hyvonen@minedu.fi Aikuiskoulutuksen paradigman
LisätiedotSuomen ja korkeatasoisen tutkimuksen kohtalonyhteys. Raimo Sepponen, prof. Elektroniikan laitos Sähkötekniikan korkeakoulu Aalto yliopisto
Suomen ja korkeatasoisen tutkimuksen kohtalonyhteys Raimo Sepponen, prof. Elektroniikan laitos Sähkötekniikan korkeakoulu Aalto yliopisto Nordic Innovation Monitor 2009 There is probably no historical
LisätiedotCurriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
LisätiedotBLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
LisätiedotFROM VISION TO CRITERIA: PLANNING SUSTAINABLE TOURISM DESTINATIONS Case Ylläs Lapland
FROM VISION TO CRITERIA: PLANNING SUSTAINABLE TOURISM DESTINATIONS Case Ylläs Lapland Tiina Merikoski, Landscape Architect (M.Sc) Aalto University School of Science and Technology Department of Architecture
LisätiedotTyösuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016. Peter Michelsson Wallstreet Asset Management Oy
Työsuojelurahaston Tutkimus tutuksi - PalveluPulssi 11.3.2016 Peter Michelsson Wallstreet Asset Management Oy Wallstreet lyhyesti Perustettu vuonna 2006, SiPa toimilupa myönnetty 3/2014 Täysin kotimainen,
Lisätiedot7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
LisätiedotSuomen JVT- ja Kuivausliikkeiden Liitto ry The Association of Finnish Damage Restoration Companies
Suomen JVT- ja Kuivausliikkeiden Liitto ry The Association of Finnish Damage Restoration Companies PL 3 00721 Helsinki www.vahinkopalvelut.net info@vahinkopalvelut.net +358-40-900 9856 TUVASA Turvallinen
Lisätiedot