19.iv. BRYOPHYTA - lehtisammalet. Bryophyta: Takakiopsida -- Polytrichopsida
|
|
- Pia Sariola
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 19.iv. BRYOPHYTA - lehtisammalet Bryophyta: Takakiopsida -- Polytrichopsida ALKIOLLISET KASVIT Polysporangiophyta moni-itiöpesäkkeelliset Lycophytina liekokasvit Euphyllophytina lehdelliset kasvit periini (itiöiden uloin kerros) gametangiot apikaalisesti paitsi Takakian arkegoniot pysty gametofyytti
2 Bryophyta - lehtisammalet synapomorfioita: useita siittiöiden ontogeniaan liittyviä ominaisuuksia gametofyytin apikaalisolu tetraedri (nelitahokas) gametofyytin lehdet gametofyytin MONIsoluiset ritsoidit lisäksi useita DNAtason ominaisuuksia poikkeuksena Takakia lajimäärältään SUURIN sammal ryhmä ~8 000 spp. Bryophyta - lehtisammalet
3 Bryophyta - lehtisammalet Takakiopsida monisoluiset ritsoidit arkegoniot apikaalisesti Bryophyta - lehtisammalet TAKAKIOPSIDA Itiöpesäkkeen kansi
4 Bryophyta - lehtisammalet Itiöpesäke kanneton TAKAKIOPSIDA Itiöpesäkkeen kansi Sphagnopsida- rahkasammalet synapomorfiat: itiöpesäkkeessä KANSI Opelt, K. ym Investigations of the structure and function of bacterial communities associated with Sphagnum mosses. Environmental Microbiology 9: rahkasolut voivat imeä 20x oman painonsa nestettä haarat kimppuina + useita DNA tason ominaisuuksia turve ekologisesti etenkin boreaalisessa vyöhykkeessä HYVIN tärkeä boreaalisen vyöhykkeen TÄRKEIN kasvisuku
5 Sphagnopsida- rahkasammalet 3 heimoa Flatbergiaceae Ambuchananiac. Sphagnac. Yamaguchi, T. ym Sphagnum (sect. Buchanania) leucobryoides sect. et. sp. nov. from Tasmania. J. Bryol. 16: ~ 200 spp. Flatbergium sericeum Ambuchanania & Eosphagnum Sphagnum A. leucobryoides E. inretortum Shaw, A. J. ym Newly resolved relationships in an early land plant lineage: Bryophyta class Sphagnopsida (peat mosses). American Journal of Botany 97: Shaw, A. J. ym Peatmoss (Sphagnum) diversification associated with Miocene northern hemisphere cooling? Molecular Phylogenetics& Evolution 55: Hübers, M. & Kerp, H Oldest known mosses discovered in Mississippian (late Visean) strata of Germany. Geology 40: I. Korpela S. wulfianum I. Korpela I. Korpela S. centrale
6 Bryophyta TAKAKIOPSIDA Andreaeopsida ---> Bryopsida synapomorfiat: lehdissä keskisuoni parafyysit pidentynyt anteridio irti repeytyvä ja kehittyvää sporofyyttiä suojaava HUNTU (aerial calyptra) konvergenssia Takakia + useita DNA tason ominaisuuksia
7 Andreaeopsida - karstasammalet Takakiopsida Andreaeopsida - karstasammalet kuivilla, avoimilla kasvupaikoilla tummia mättäitä kivillä, kallioilla ~ 50 spp. 2 sukua Andreaea Andreaeobryum Andreaea silikaattikallioilla, Andreaeaobryum kalkkipitoisilla pesäke aukeaa 4:llä pitkittäisuurteella
8 Oedipodiopsida --- Bryopsida Takakiopsida pitkä pesäkeperä endotekium erilaistunut (keskipatsas & sitä ympäroivä SYLINTERIMÄINEN itiöiden emosolujen vaippa) Endotekiumin erilaistuminen Marchantiophyta > itiöt Sphagnopsida & Andreaeopsida Anthocerotophyta keskipatsas Takakiopsida Oedipodiopsida--Bryopsida itiöt & keskipatsas
9 Oedipodiopsida --- Bryopsida Takakiopsida pitkä pesäkeperä endotekium erilaistunut (keskipatsas & sitä ympäroivä SYLINTERIMÄINEN itiöiden emosolujen vaippa) Suuvarukselliset lehtisammalet Takakiopsida pesäkkeen suulla suuvarus
10 Polytrichopsida - karhunsammalet Takakiopsida Neil Bell Atrichum undulatum
11 Polytrichopsida - karhunsammalet synapomorfiat: lh hammaslaitaiset epifragmi monilla lajeilla lh yläpinnalla pitkittäiset lamellit ja ritsoidien peittämä huntu pseudomesofylli monet lajit suurikokoisia, HYVIN kehittynyt johtosolukko etenkin avoimien kasvupaikkojen lajistoa ~ 2o0 spp. 19 sukua suuvarushampaat muodostuneet KOKONAISISTA soluista 16/32/64 suuvarushammasta anbg.gov.au/bryophyte/photos-captions/irwan-rainforest-2006.html Neil Bell Lyellia sp.
12 Neil Bell Polytrichadelphus magellanicus Sean Edwards
13 karhunsammalen lh kosteana kuivana
14 TAXON 64 (5) October 2015: Bell & al. Delongia gen. nov., a new genus of Polytrichaceae Delongia gen. nov., a new genus of Polytrichaceae (Bryophyta) with two disjunct species in East Africa and the Himalaya Neil E. Bell,1, 2, 3 Isuru U. Kariyawasam,4 Terry A.J. Hedderson5 & Jaakko Hyvönen3 1 Royal Botanic Garden Edinburgh, 20a Inverleith Row, Edinburgh EH3 5LR, Scotland, U.K. 2 Botanical Museum, Finnish Museum of Natural History, University of Helsinki, P.O. Box 7, Helsinki, Finland 3 Department of Biosciences (Biocenter 3),University of Helsinki, P.O. Box 65, Helsinki, Finland 4 Department of Botany, University of Sri Jayewardenepura, Gangodalwila, Nugegoda, Sri Lanka 5 Department of Biological Sciences and Bolus Herbarium, University of Cape Town, Private Bag, 7700 Rondebosch, South Africa Author for correspondence: Neil E. Bell, N.Bell@rbge.ac.uk ORCID: NEB, IUK, TAJH, org/ DOI Abstract Although the family Polytrichaceae contains the largest and structurally most complex of all mosses, a number of distantly related lineages share a relatively reduced gametophytic morphology and have historically been conflated under polyphyletic genera, most notably Oligotrichum s.l. Based on new and newly identified collections, phylogenetic analysis of nucleotide data, scanning electron microscopy and relaxed-clock divergence time estimation, we recognise O. glaciale and O. cavallii under the new genus Delongia, which is more closely related to Psilopilum, Atrichum and Steereobryon than to Oligotrichum. The two species are mutually highly distinct in both morphological and molecular characters, with D. glacialis occurring across the Himalaya from Pakistan to Yunnan and D. cavallii found in the East African Rift Mountains and on the island of Réunion. Divergence time estimation suggests that the lineages represented by the extant species diverged from each other around the Oligocene-Miocene boundary (~23 Ma), contemporaneous with the origins of the East African Rift system and ongoing uplift of the Qinghai-Tibetan Plateau, while Delongia most likely shares a common ancestor in the Eocene (56 34 Ma) either with the arctic-subarctic genus Psilopilum or with Atrichum and Steereobryon. Keywords bryophyte phylogeny; East African Rift; mosses; Oligotrichum; relaxed-clock dating; Réunion Supplementary Material The Electronic Supplement (Figs. S1 S2; Appendix S1 with full species descriptions) is available in the Supplementary Data section of the online version of this article at The Bell, N. & Hyvönen, J Phylogeny of the moss class Polytrichopsida (Bryophyta): genericlevel structure and an anomalous 18S gene tree. Molecular Phylogenetics and Evolution 55: Bell, N. & Hyvönen, J A phylogenetic circumscription of Polytrichastrum (Polytrichaceae): reassessment of sporophyte morphology supports molecular phylogeny. American Journal of Botany 97: Hyvönen J Bryophyte illustrated on a coin. Bryologist 93: 256.
15 YHTEENVETO lhsammalilla sekä gametofyytin että SPOROFYYTIN rakenteessa suurta rakenteellista vaihtelua rahkasammalet ekologisesti HYVIN tärkeä kasviryhmä arktisilla ja boreaalisilla alueilla useimmilla lhsammalilla itiöpesäkkeen suulla SUUVARUS säätelee itiöiden vapautumista itiöt vapautuvat useimmissa lajeissa PITKÄN AJAN kuluessa vrt. maksasammelet karhunsammalilla pitkälle erilaistunut gametofyytti mm. johtosolukko HYVIN kehittynyt
ALKIOLLISET KASVIT. 18.iv. MAKSASAMMALET menestystä pienoiskoossa. Marchantiophyta - maksasammalet. sammalet. Polysporangiophyta monipesäkkeelliset
18.iv. MAKSASAMMALET menestystä pienoiskoossa Marchantiophyta - maksasammalet ALKIOLLISET KASVIT Polysporangiophyta monipesäkkeelliset Lycophytina liekomaiset kasvit Euphyllophytina lehdelliset kasvit
Lisätiedot21.iv. Tetraphidopsida - lahosammalet. Takakiopsida
21.iv. Bryophyta: Tetraphidopsida -- Bryopsida Tetraphidopsida - lahosammalet Takakiopsida suuvaruksessa vain 4 suurta hammasta, muodostuneet kokonaisista soluista Tetraphis pellucida lahopuulla Tetrodontium
Lisätiedot1. Polysporangiophyta monipesäkkeelliset. 2. Tracheophyta putkisolulliset kasvit. Polysporangiophyta
22.iv. 1. Polysporangiophyta monipesäkkeelliset 2. Tracheophyta putkisolulliset kasvit 3. yhteenveto Polysporangiophyta Polysporangiophyta monipesäkkeelliset Lycophytina liekomaiset kasvit Euphyllophytina
Lisätiedot1. ritsomorfiset liekomaiset kasvit
25.iv. 1. ritsomorfiset liekomaiset kasvit 2. monilofyytit 3. kortemaiset kasvit 4. yhteenveto Lepidodendrales Isoetaceae lahnaruohot Selaginellaceae Lycopodiaceae mähkäkasvit liekokasvit LIGULA mikrofyllit
Lisätiedot(monipesäkkeisiin) verrattuna pieniä ja rakenteeltaan yksinkertaisia. Tämän vuoksi konvergenttisen evoluution
K a s v i t i e t e e n p ä i v ä t 2 0 1 3 Lehtisammalten makromorfologia konvergenssia yksinkertaisissa alkiollisissa kasveissa Neil Bell ja Jaakko Hyvönen Lehtisammalet ovat pieniä, yksinkertaisia kasveja,
LisätiedotKASVIKUNTA kl 2016
526128 KASVIKUNTA kl 2016 Luennot klo 10-12 salissa 6602 11.4. Ma johdanto kasvikuntaan 12.4. Ti Chlorophyta 14.4. To Streptophyta 15.4. Pe vanhimmat alkiolliset kasvit 18.4. Ma maksasammalet 19.4. Ti
Lisätiedot15.iv. ALKIOLLISET KASVIT vedestä maalle. 2. vanhimmat fossiilit & ympäristö
15.iv. ALKIOLLISET KASVIT vedestä maalle 1. alkiolliset kasvit 2. vanhimmat fossiilit & ympäristö 3. sukupolvenvuorottelu 4. yhteenveto KASVIEN PÄÄRYHMÄT CHLOROPHYTA STREPTOPHYTA miksi juuri embryofyytit?
LisätiedotFungi infecting cultivated moss can also cause diseases in crop plants
Fungi infecting cultivated moss can also cause diseases in crop plants SEMINAR ON PEST RISK ASSESSMENT 2-3 October 2012, Helsinki, Finland 9.10.2012 1 Fungi infecting cultivated moss can also cause diseases
LisätiedotEQUISETALES - kortemaiset kasvit
13.5. 1. Equisetales 2. Marattiales 3. köykäispesäkkeiset saniaiset 4. yhteenveto EQUISETALES - kortemaiset kasvit 4 heimoa Calamitaceae Equisetac. Gondwanostachyac. Tchernoviac. Pseudoborniales Sphenophyllales
Lisätiedot4.v. 1. Glossopteridales. 2. Bennettitales. 3. Caytonia. 4. koppisiemeniset. 5. yhteenveto MEDULLOSACEAE MAGNOLIOPSIDA
4.v. 1. Glossopteridales 2. Bennettitales 3. Caytonia 4. koppisiemeniset 5. yhteenveto Tetraxylopteris Archaeopteris Elkinsia Lyginopteris MEDULLOSACEAE L O S A C E A E Callistophyton CYCADACEAE ZAMIACEAE
Lisätiedot29.iv. 1. käpypalmut 2. fossiilisia siemenkasveja. 3. neidonhiuspuu 4. yhteenveto. bilateraalinen siitepöly
29.iv. 1. käpypalmut 2. fossiilisia siemenkasveja 3. neidonhiuspuu 4. yhteenveto Tetraxylopteris bilateraalinen siitepöly aukeamiskohta (monoaperture) pölykammion kalvoton pohja kerroksellinen siemenkuori
Lisätiedot14.iv. STREPTOPHYTA - vinosiimaiset
14.iv. STREPTOPHYTA - vinosiimaiset KASVIEN PÄÄRYHMÄT 2016 CHLOROPHYTA STREPTOPHYTA Turmel, M. ym. 2002. Mol. Biol. Evol. 19:24-38 Lemieux, C. ym. 2000: Ancestral chloroplast genome in Mesostigma viride
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Lisätiedot2.v. 1. havupuut: Pinaceae Podocarpac. Araucariac. 2. yhteenveto HAVUPUUT BENNETTITALES
2.v. 1. havupuut: Pinaceae Podocarpac. Araucariac. 2. yhteenveto Tetraxylopteris Archaeopteris Elkinsia Lyginopteris MEDULLOSACEAE Callistophyton CYCADACEAE ZAMIACEAE Corystospermum Ginkgo Cordaites CONIFERALES
LisätiedotCopernicus, Sentinels, Finland. Erja Ämmälahti Tekes,
Copernicus, Sentinels, Finland Erja Ämmälahti Tekes, 24.5.2016 Finnish Space industry in the European context European Space industry has been constantly growing and increasing its direct employment in
LisätiedotExperimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
LisätiedotLataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli Lataa Kirjailija: Pekka Rapeli ISBN: 9789523022232 Sivumäärä: 173 Formaatti: PDF Tiedoston koko: 11.54 Mb Opioid substitution
LisätiedotMetsän pohjakerros. bi2. 8.10.2012 Mirjami Kaasinen ja Heidi Routama 8D
Metsän pohjakerros bi2 8.10.2012 Mirjami Kaasinen ja Heidi Routama 8D Summary We researched the ground layer of the forest (especially mosses and lichens) and made two different researches: the water absorption
Lisätiedot13.11. Tulosten arviointi. tulosten arviointi. voimmeko luottaa saamiimme tuloksiin?
13.11. tulosten arviointi Tulosten arviointi voimmeko luottaa saamiimme tuloksiin? onko osa saaduista tuloksista sattumanvaraisia? mitkä OSAT puusta ovat luotettavimpia? 1 KONSENSUSDIAGRAMMI Useita yhtä
LisätiedotResults on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
LisätiedotSupporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
LisätiedotCapacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
LisätiedotJulkaisun laji Opinnäytetyö. Sivumäärä 43
OPINNÄYTETYÖN KUVAILULEHTI Tekijä(t) SUKUNIMI, Etunimi ISOVIITA, Ilari LEHTONEN, Joni PELTOKANGAS, Johanna Työn nimi Julkaisun laji Opinnäytetyö Sivumäärä 43 Luottamuksellisuus ( ) saakka Päivämäärä 12.08.2010
LisätiedotGap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
LisätiedotVoice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto
Voice Over LTE (VoLTE) By Miikka Poikselkä;Harri Holma;Jukka Hongisto If you are searched for a book by Miikka Poikselkä;Harri Holma;Jukka Hongisto Voice over LTE (VoLTE) in pdf form, then you have come
LisätiedotAKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY
T073/A16/2016 Liite 1 / Appendix 1 Sivu / Page 1(6) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY KEMIALLISEN ASEEN KIELTOSOPIMUKSEN INSTITUUTTI FINNISH INSTITUTE FOR VERIFICATION OF THE
LisätiedotMEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
Lisätiedot16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
LisätiedotSupplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
LisätiedotIntegration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Who we are FIN-CLARIN University of Helsinki The Language Bank of Finland CSC - The Center for
LisätiedotHMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism
HMG-CoA Reductase Inhibitors and safety the risk of new onset diabetes/impaired glucose metabolism Final SmPC and PL wording agreed by PhVWP December 2011 SUMMARY OF PRODUCT CHARACTERISTICS New Class Warnings
LisätiedotYksi elämä -hanke. Kuluttajakysely Yksi elämä -hankkeesta Marraskuu 2016
Yksi elämä -hanke Kuluttajakysely Yksi elämä -hankkeesta Marraskuu 2016 Johdanto Tämän kyselytutkimuksen Yksi elämä hankkeelle on toteuttanut YouGov Finland Tiedot kerättiin web-kyselynä 2.11. 6.11.2016
LisätiedotOpintomatkat PDF. ==>Download: Opintomatkat PDF ebook By Risto Antikainen
Opintomatkat PDF ==>Download: Opintomatkat PDF ebook By Risto Antikainen Opintomatkat PDF By Risto Antikainen - Are you searching for Opintomatkat pdf Books? Now, you will be happy that Opintomatkat PDF
Lisätiedot17.6.2015 Näkymä museoiden edestä, puutarha musoiden välissä / View from the front of the museums, garden between the museums
17.6.2015 Näkymä museoiden edestä, puutarha musoiden välissä / View from the front of the museums, garden between the museums 17.6.2015 Näkymä suoraan museoiden edestä / View from the front of the museums
LisätiedotFinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
LisätiedotReturns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
LisätiedotA special dividend is included in the index as a net amount and it is calculated as follows: ) = - ( 0.1761 EUR * 844 452 759) = - 148713280,75 EUR
Exchange Notice April 25, 2007 Series 18/07 OMXH25 STOCK INDEX SPECIAL DIVIDEND ADJUSTMENT: TIETOENATOR OYJ The AGM of TeliaSonera AB has approved a dividend of EUR 0.6849 per share which will be effective
LisätiedotLataa Legislating the blind spot - Nikolas Sellheim. Lataa
Lataa Legislating the blind spot - Nikolas Sellheim Lataa Kirjailija: Nikolas Sellheim ISBN: 9789524849012 Sivumäärä: 292 Formaatti: PDF Tiedoston koko: 22.52 Mb For decades the Canadian seal hunt has
LisätiedotExport Demand for Technology Industry in Finland Will Grow by 2.0% in 2016 GDP growth 2016/2015, %
Russia Rest of Eastern Europe Brazil America Middle East and Africa Export Demand for Technology Industry in Finland Will Grow by 2.% in 216 GDP growth 216/215, % 9 8 7 6 5 4 3 2 1-1 -2-3 -4 Average growth:
Lisätiedot1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
LisätiedotLUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10)
RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.
LisätiedotIncrease of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
LisätiedotSELL Student Games kansainvälinen opiskelijaurheilutapahtuma
SELL Student Games kansainvälinen opiskelijaurheilutapahtuma Painonnosto 13.5.2016 (kansallinen, CUP) Below in English Paikka: Nääshalli Näsijärvenkatu 8 33210 Tampere Alustava aikataulu: Punnitus 12:00-13:00
LisätiedotCapacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
Lisätiedot3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ
Puhe ja kieli, 27:4, 141 147 (2007) 3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Soile Loukusa, Oulun yliopisto, suomen kielen, informaatiotutkimuksen ja logopedian laitos & University
LisätiedotA special dividend is included in the index as a net amount and it is calculated as follows:
Exchange Notice March 20, 2007 Series 14/07 OMXH25 STOCK INDEX SPECIAL DIVIDEND ADJUSTMENT: RAUTARUUKKI OYJ The AGM of Rautaruukki Oyj has approved a dividend of EUR 2.00 per share which will be effective
LisätiedotEfficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
LisätiedotUusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
LisätiedotAccommodation statistics
Transport and Tourism 2013 Accommodation statistics 2013, February Nights spent by foreign tourists in Finland down by 2.5 per cent in February 2013 The number of recorded nights spent by foreign tourists
LisätiedotMiehittämätön meriliikenne
Rolls-Royce & Unmanned Shipping Ecosystem Miehittämätön meriliikenne Digimurros 2020+ 17.11. 2016 September 2016 2016 Rolls-Royce plc The 2016 information Rolls-Royce in this plc document is the property
LisätiedotLähivõrdlusi Lähivertailuja19
Lähivõrdlusi Lähivertailuja19 P E A T O I M E T A J A A N N E K A T R I N K A I V A P A L U T O I M E T A N U D E V E M I K O N E, K I R S T I S I I T O N E N, M A R I A - M A R E N S E P P E R E E S T
Lisätiedotmake and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
LisätiedotHotel Pikku-Syöte: accommodation options and booking
Hotel Pikku-Syöte: accommodation options and booking 13 th European Forest Pedagogics Congress 2-5 October 2018 (Accomodation information in Finnish at the end) Hotel Pikku-Syöte has total of 82 rooms
LisätiedotPaikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO
Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/
LisätiedotThe CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO2-päästöt 2.1.216 1 (17) Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh/ Month 5 4 3 2 1 7 8 9 1 1 2 3 4 5 6 7 8 9 1 1 2 3 4 5
LisätiedotT U O T T E E T P R O D U C T S
TUOTTEET PRODUCTS TUOTTEIDEN VÄRIMALLIT / AVAILABLE PRODUCT COLOURS SISÄLLYS TABLE OF CONTENTS MUSTA / BLACK VALKOINEN / WHITE HARMAA / GRAY LAMINAATIN VÄRIMALLIT / LAMINATE COLOURS VÄRITÖN / NATURAL TARINAMME
LisätiedotPlasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
LisätiedotT U O T T E E T P R O D U C T S
TUOTTEET PRODUCTS TUOTTEIDEN VÄRIMALLIT / AVAILABLE PRODUCT COLOURS SISÄLLYS TABLE OF CONTENTS TARINAMME / OUR STORY...4 SÄILYTINKALUSTEET / STORAGE FURNITURE...6 KAIKU...8 APILA... 10 VALO... 12 TUKKI...
LisätiedotAKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY
T043 Liite 1.05 / Appendix 1.05 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY FIMLAB LABORATORIOT OY FIMLAB MEDICAL LABORATORIES LTD Tunnus Code Yksikkö tai toimintoala
Lisätiedottgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
LisätiedotAccommodation statistics
Transport and Tourism 2011 Accommodation statistics 2011, January Nights spent by foreign tourists in Finland increased by per cent in January The number of recorded nights spent by foreign tourists at
LisätiedotTechnische Daten Technical data Tekniset tiedot Hawker perfect plus
Technische Daten Technical data Tekniset tiedot Hawker perfect plus PzS-Zellen Hawker perfect plus, mit Schraubverbindern, Abmessungen gemäß DIN/EN 60254-2 und IEC 254-2 Serie L PzS-cells Hawker perfect
LisätiedotInfrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
LisätiedotYhteistyökumppaniksi Toyota Tsusho Nordic/ Toyota Tsusho Corporationille?
Yhteistyökumppaniksi Toyota Tsusho Nordic/ Toyota Tsusho Corporationille? 10/2013 www.ttnordic.fi www.toyota-tsusho.com/english Toyota Tsusho Nordic ja Toyota Tsusho Corporation (TTC) lyhyesti Toiminta
LisätiedotNational Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
LisätiedotBounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
LisätiedotFETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
LisätiedotMaster's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
LisätiedotKasvu keskimäärin / Average growth: +2,9 % Japani Japan
Maailmantalouden kasvun jakautuminen 21e teknologiateollisuuden vientiosuuksin Breakdown of World Economic Growth in 21e with the Export Shares of Technology Industry 1 9 8 7 6 5 4 3 2 1 BKT:n kasvu 21
LisätiedotChoose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
LisätiedotKansallinen hankintailmoitus: Mikkelin ammattikorkeakoulu Oy : Palvelimet ja kytkin
Finland Tender Kansallinen hankintailmoitus: Mikkelin ammattikorkeakoulu Oy : Palvelimet ja kytkin Tarjoukset 8.4.2011 klo 12.00 mennessä osoitteeseen: Tarjous: Palvelimet ja kytkin, Janne Strömberg, MAMK.Satu
LisätiedotLakimies PDF. ==>Download: Lakimies PDF ebook
Lakimies PDF ==>Download: Lakimies PDF ebook Lakimies PDF - Are you searching for Lakimies Books? Now, you will be happy that at this time Lakimies PDF is available at our online library. With our complete
LisätiedotA special dividend is included in the index as a net amount and it is calculated as follows:
Exchange Notice March 22, 2007 Series 15/07 OMXH25 STOCK INDEX SPECIAL DIVIDEND ADJUSTMENT: TIETOENATOR OYJ The AGM of TietoEnator Oyj has approved a dividend of EUR 1.20 per share which will be effective
LisätiedotNetwork to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO 2 päästöt 23.1.218 1 () Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh / month 5 4 3 2 1 7 8 9 1 11 12 1 2 3 4 5 6 7 8 9 1 11
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO 2 päästöt 12.12.2 1 () Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh / month 5 4 3 2 1 7 8 9 1 11 12 1 2 3 4 5 6 7 8 9 1 11 12
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO 2 päästöt 18.2.219 1 (17) Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh / month 5 4 3 2 1 1 17 2 17 3 17 4 17 5 17 6 17 7 17
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
GWh / kk GWh / month Sähköntuotannon polttoaineet ja CO2-päästöt 24.4.219 1 (17) Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 5 4 3 2 1 1 17 2 17 3 17 4 17 5 17 6 17 7 17 8
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO2-päästöt 3.6.217 1 (17) Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh/ Month 5 4 3 2 1 1 2 3 4 5 6 7 8 9 1 11 1 2 3 4 5 6 7 8
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO2-päästöt 25.9.217 1 (17) Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh/ Month 5 4 3 2 1 7 8 9 1 1 2 3 4 5 6 7 8 9 1 1 17 2 17
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO2-päästöt 31.1.2 1 () Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh/ Month 5 4 3 2 1 7 8 9 1 1 2 3 4 5 6 7 8 9 1 1 2 3 4 5 6 7
LisätiedotSupplementary Material : Baker et al. 1
Supplementary Material : Baker et al. 1 Supplementary Material Title: Species identity and human consumption of beaked whales in the Gilbert Islands, Republic of Kiribati Authors: C. Scott Baker, Al Hutt,
LisätiedotSammalet ja jäkälät perinnemaisemassa
Jäkäliä on Suomessa 1594 ja sammalia 892 lajia Jäkälistä uhanalaisia on noin 15 % (271) ja sammalista 20% (183) Molemmissa ryhmissä kivialustalla, maalla, puiden rungolla ja lahopuulla kasvavia lajeja
LisätiedotPosition Position Passengers Percentage Passengers Percentage of all visitors 2013 of all visitors
Suomen matkatoimistoalan liitto ry - SMAL Association of Finnish Travel Agents - AFTA TOP TEN TRAVEL DESTINATIONS FROM FINLAND IN 2014 Based on the annual statistics of AFTA, air based package holidays,
LisätiedotSupplies
Supplies - 239236-2018 05/06/2018 S105 - - Supplies - Contract notice - Open procedure I. II. III. IV. VI. Finland-Seinäjoki: Wheelchairs 2018/S 105-239236 Contract notice Supplies Directive 2014/24/EU
LisätiedotAKKREDITOITU SERTIFIOINTIELIN ACCREDITED CERTIFICATION BODY
S017 Liite 1.09 / Appendix 1.09 Sivu / Page 1(5) AKKREDITOITU SERTIFIOINTIELIN ACCREDITED CERTIFICATION BODY EUROFINS EXPERT SERVICES OY EUROFINS EXPERT SERVICES LTD. Tunnus Code Yksikkö tai toimintoala
LisätiedotSähköntuotanto energialähteittäin Power generation by energy source
Sähköntuotannon polttoaineet ja CO 2 päästöt 18.9.218 1 (17) Sähköntuotanto energialähteittäin Power generation by energy source 8 7 6 GWh / kk GWh / month 5 4 3 2 1 7 16 8 16 9 16 1 16 11 16 12 16 1 17
LisätiedotTIETEEN PÄIVÄT OULUSSA 1.-2.9.2015
1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti
LisätiedotAKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY
T013 Liite 1.03 / Appendix 1.03 Sivu / Page 1(8) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY TYÖTERVEYSLAITOS, LABORATORIOTOIMINTA FINNISH INSTITUTE OF OCCUPATIONAL HEALTH, LABORATORIES
LisätiedotTESTBED FOR NEXT GENERATION REASEARCH & INNOVATION
PUBLIC-PRIVATE PARTNERSHIPS FOR NEW INNOVATIONS ACADEMIC RESEARCH INDUSTRY + PHARMA R&D SPEND Important decisions in drug discovery The Problem: It difficult to develop novel therapies that differentiate
LisätiedotToimitusketjun vastuullisuus ja riskien hallinta
Toimitusketjun vastuullisuus ja riskien hallinta Fibs PRO koulutus Tapahtumatalo Bank, Unioninkatu 20 1 SAFER, SMARTER, GREENER Toimitusketjun vastuullisuus ja riskien hallinta 1. osa: Toimitusketjun vastuullisuuden
LisätiedotKansallinen hankintailmoitus: Tampereen kaupunki : Ulkoalueiden hoito
Finland Tender Kansallinen hankintailmoitus: en kaupunki : Ulkoalueiden hoito Tarjoukset 12.4.2011 klo 15.00 mennessä osoitteeseen: en kaupunki, kirjaamo TRE:2707/02.07.01/2011 PL 487 33101 Hankintayksikön
LisätiedotAir based package holidays abroad in 2017 and 2016 (including tailor made packages and long-haul cruises without flights)
Air based package holidays abroad in 2017 and 2016 (including tailor made packages and long-haul cruises without flights) Difference 2017/2016 EUROPE 2017 2016 % All Spain 264 983 235 650 12,4 % Canary
LisätiedotMALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
LisätiedotKMTK lentoestetyöpaja - Osa 2
KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...
Lisätiedot812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
LisätiedotHankintailmoitus: Pohjois-Savon sairaanhoitopiirin kuntayhtymä/kiinteistöyksikkö : Puijon sairaalan Pääaula-alueen uudistus, Sähköurakka
Finland Tender Hankintailmoitus: Pohjois-Savon sairaanhoitopiirin kuntayhtymä/kiinteistöyksikkö : Puijon sairaalan Pääaula-alueen uudistus, Sähköurakka Tarjoukset 6.5.2011 klo 15.00 mennessä osoitteeseen:
LisätiedotHumanististen alojen aineistojen erityispiirteet ja aineistonhallinta METODIFESTIVAALI 19.-20.8.2015
Humanististen alojen aineistojen erityispiirteet ja aineistonhallinta METODIFESTIVAALI 19.-20.8.2015 KATJA FÄLT TIETEENALA-ASIANTUNTIJA, FT Katja.Falt@uta.fi Humanistien aineistot Monimuotoisia ja monipuolisia
LisätiedotPersonal Letter. Letter - Address. Matti Meikäläinen Puistokatu 17 A Helsinki Finland
- Address Matti Meikäläinen Puistokatu 17 A 01234 Helsinki Finland Standard English Address format: name of recipient street number + street name name of town + region/state + zip/postal code. Jeremy Rhodes
Lisätiedot