B3206 Microbial Genetics
|
|
- Seppo Ahonen
- 4 vuotta sitten
- Katselukertoja:
Transkriptio
1 Prof. Fahd M. Nasr Lebanese university Faculty of sciences I Department of Natural Sciences fnasr@ul.edu.lb B3206 Microbial Genetics 1
2 Eukaryotic M. G. The yeast Saccharomyces cerevisiae as a genetic model system Lectures XIII and XIV Why yeast as genetics model Basic cellular mechanisms conserved Unicellular Grow on readily controlled, defined media Ideal life cycle Very compact genome Quick to map a phenotype producing gene Single gene deletion mutants One third of the genes have counterparts in human 2
3 Yeast genetics In 1996 Yeast genes 1/3 characterised by genetic analysis 1/3 shows homology to known genes 1/3 orphans 5% yeast genes with introns very few have more than one The intergenic space between genes is only between 200 and 1,000bp Yeast genome analysis Major goal function of every gene Large projects and numerous approaches Micro array analysis Gene expression profiles Binding sites in the genome for all transcription factors A complete set of more than 6,000 deletion mutants is available for research Various approaches to analyse the properties of these mutants Tag yeast genes to GFP protein detection and microscopic localisation Different global protein interaction projects are ongoing 3
4 Yeast genes: nomenclature 3 letters and up to 3 numbers: CDC28 Wild type capital letters in italics: MEC1, HOG1, CDC28... Recessive mutant small letters in italics: tps1, rho1, cdc28 Mutant alleles are designated with a dash and a number tps1-1, rho1-23, cdc28-2 Gene deletion mutation write genetic marker used for deletion tps1d::his3 A protein a capital letter at the beginning and not in italics often a "p" is added at the end: Tps1p, Rho1p, Cdc28p Yeast genes: nomenclature Many genes systematic sequencing : YDR518C, YML016W..., where Y stands for yeast The second letter represents the chromosome (D=IV, M=XIII...) L or R stand for left or right chromosome arm The three-digit number stands for the ORF counted from the centromere on that chromosome arm C or W stand for Crick or Watson indicate the strand or direction of the ORF Some genes do not follow this nomenclature HO, MATa, MATa 4
5 Two possible approaches A reverse genetic approach A gene of interest is disrupted The resulting phenotype is studied A forward genetic approach A phenotype of interest is chosen Screen a pool of randomly generated mutants Both have been equally effective The yeast genome Excellent model 5
6 Gene deletion in yeast ~50nc X WT CBK1 HIS3 CBK1 DNA cassette X Chromosome XIV Dcbk1::HIS3 HIS3 Chromosome XIV Yeast genetics: markers and strains Genetic markers for selection Commonly genetic markers HIS3, URA3, TRP1, LEU2, LYS2, ADE2 The ade2 mutation cells turn red The first markers fermentation markers: SUC, MAL, GAL GAL genes encode the enzymes needed to take up galactose and convert it to glucose-6-phosphate 6
7 Schematic representation of purine metabolism in S. cerevisiae 7
8 The art and design of genetic screens: yeast Transcriptional control of galactose-utilizing genes in yeast 3 genes (GAL1, GAL7 and GAL10) enzymes that function in the galactose metabolic pathway GAL1 galactokinase GAL7 galactose transferase GAL10 galactose epimerase 8
9 Galactose metabolizing pathway of yeast Transcriptional control of galactose-utilizing genes in yeast Pathway produces D-glucose 6-phosphate glycolytic pathway and is metabolized by genes that are continuously transcribed In absence of galactose, GAL genes are not transcribed GAL genes rapidly induced by galactose and absence of glucose Analogous to E. coli lac operon repression by glucose 9
10 Transcriptional control of galactose-utilizing genes in yeast GAL genes are near each other but do not constitute an operon GAL4 unlinked gene repressor protein Binds a promoter element UAS G UAS is located between GAL1 and GAL10 Transcription occurs in both directions from UAS G Galactose absent GAL4p +GAL80p bind the UAS G transcription does not occur Galactose present galactose binds GAL80p and GAL4p amino acids are phosphorylated Galactose acts as an inducer by causing a conformation change in GAL4p/GAL80p Absence of galactose 10
11 Presence of galactose Repression of the GAL1 gene in yeast 11
12 How genes respond to environmental stimuli 12
13 Scer TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACA Spar CTATGTTGATCTTTTCAGAATTTTT-CACTATATTAAGATGGGTGCAAAGAAGTGTGATTATTATATTACATCGCTTTCCTATCATACACA GAL10 Smik GTATATTGAATTTTTCAGTTTTTTTTCACTATCTTCAAGGTTATGTAAAAAA-TGTCAAGATAATATTACATTTCGTTACTATCATACACA Sbay TTTTTTTGATTTCTTTAGTTTTCTTTCTTTAACTTCAAAATTATAAAAGAAAGTGTAGTCACATCATGCTATCT-GTCACTATCACATATA * * **** * * * ** ** * * ** ** ** * * * ** ** * * * ** * * * TBP Scer TATCCATATCTAATCTTACTTATATGTTGT-GGAAAT-GTAAAGAGCCCCATTATCTTAGCCTAAAAAAACC--TTCTCTTTGGAACTTTCAGTAATACG Spar TATCCATATCTAGTCTTACTTATATGTTGT-GAGAGT-GTTGATAACCCCAGTATCTTAACCCAAGAAAGCC--TT-TCTATGAAACTTGAACTG-TACG Smik TACCGATGTCTAGTCTTACTTATATGTTAC-GGGAATTGTTGGTAATCCCAGTCTCCCAGATCAAAAAAGGT--CTTTCTATGGAGCTTTG-CTA-TATG Sbay TAGATATTTCTGATCTTTCTTATATATTATAGAGAGATGCCAATAAACGTGCTACCTCGAACAAAAGAAGGGGATTTTCTGTAGGGCTTTCCCTATTTTG ** ** *** **** ******* ** * * * * * * * ** ** * *** * *** * * * GAL4 GAL4 GAL4 Scer CTTAACTGCTCATTGC-----TATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCT Spar CTAAACTGCTCATTGC-----AATATTGAAGTACGGATCAGAAGCCGCCGAGCGGACGACAGCCCTCCGACGGAATATTCCCCTCCGTGCGTCGCCGTCT Smik TTTAGCTGTTCAAG ATATTGAAATACGGATGAGAAGCCGCCGAACGGACGACAATTCCCCGACGGAACATTCTCCTCCGCGCGGCGTCCTCT Sbay TCTTATTGTCCATTACTTCGCAATGTTGAAATACGGATCAGAAGCTGCCGACCGGATGACAGTACTCCGGCGGAAAACTGTCCTCCGTGCGAAGTCGTCT ** ** ** ***** ******* ****** ***** *** **** * *** ***** * * ****** *** * *** GAL4 Scer TCACCGG-TCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAA-----TACTAGCTTTT--ATGGTTATGAA Spar TCGTCGGGTTGTGTCCCTTAA-CATCGATGTACCTCGCGCCGCCCTGCTCCGAACAATAAGGATTCTACAAGAAA-TACTTGTTTTTTTATGGTTATGAC Smik ACGTTGG-TCGCGTCCCTGAA-CATAGGTACGGCTCGCACCACCGTGGTCCGAACTATAATACTGGCATAAAGAGGTACTAATTTCT--ACGGTGATGCC Sbay GTG-CGGATCACGTCCCTGAT-TACTGAAGCGTCTCGCCCCGCCATACCCCGAACAATGCAAATGCAAGAACAAA-TGCCTGTAGTG--GCAGTTATGGT ** * ** *** * * ***** ** * * ****** ** * * ** * * ** *** MIG1 Scer GAGGA-AAAATTGGCAGTAA----CCTGGCCCCACAAACCTT-CAAATTAACGAATCAAATTAACAACCATA-GGATGATAATGCGA------TTAG--T Spar AGGAACAAAATAAGCAGCCC----ACTGACCCCATATACCTTTCAAACTATTGAATCAAATTGGCCAGCATA-TGGTAATAGTACAG------TTAG--G Smik CAACGCAAAATAAACAGTCC----CCCGGCCCCACATACCTT-CAAATCGATGCGTAAAACTGGCTAGCATA-GAATTTTGGTAGCAA-AATATTAG--G Sbay GAACGTGAAATGACAATTCCTTGCCCCT-CCCCAATATACTTTGTTCCGTGTACAGCACACTGGATAGAACAATGATGGGGTTGCGGTCAAGCCTACTCG **** * * ***** *** * * * * * * * * ** MIG1 TBP Scer TTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCG--ATGATTTTT-GATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCAC-----TT Spar GTTTT--TCTTATTCCTGAGACAATTCATCCGCAAAAAATAATGGTTTTT-GGTCTATTAGCAAACATATAAATGCAAAAGTTGCATAGCCAC-----TT Smik TTCTCA--CCTTTCTCTGTGATAATTCATCACCGAAATG--ATGGTTTA--GGACTATTAGCAAACATATAAATGCAAAAGTCGCAGAGATCA-----AT Sbay TTTTCCGTTTTACTTCTGTAGTGGCTCAT--GCAGAAAGTAATGGTTTTCTGTTCCTTTTGCAAACATATAAATATGAAAGTAAGATCGCCTCAATTGTA * * * *** * ** * * *** *** * * ** ** * ******** **** * Scer Spar Smik Sbay Scer Spar Smik Sbay Conservation of Motifs TAACTAATACTTTCAACATTTTCAGT--TTGTATTACTT-CTTATTCAAAT----GTCATAAAAGTATCAACA-AAAAATTGTTAATATACCTCTATACT TAAATAC-ATTTGCTCCTCCAAGATT--TTTAATTTCGT-TTTGTTTTATT----GTCATGGAAATATTAACA-ACAAGTAGTTAATATACATCTATACT TCATTCC-ATTCGAACCTTTGAGACTAATTATATTTAGTACTAGTTTTCTTTGGAGTTATAGAAATACCAAAA-AAAAATAGTCAGTATCTATACATACA TAGTTTTTCTTTATTCCGTTTGTACTTCTTAGATTTGTTATTTCCGGTTTTACTTTGTCTCCAATTATCAAAACATCAATAACAAGTATTCAACATTTGT * * * * * * ** *** * * * * ** ** ** * * * * * *** * TTAA-CGTCAAGGA---GAAAAAACTATA TTAT-CGTCAAGGAAA-GAACAAACTATA TCGTTCATCAAGAA----AAAAAACTA.. TTATCCCAAAAAAACAACAACAACATATA * * ** * ** ** ** GAL1 Factor footprint Conservation island Yeast genetics: markers and strains Certain antibiotic resistance markers used in transformation kanamycin resistance = kan R There are many yeast strains in use in the laboratories: W303-1A, S288C, S1278b, SK1, BY
14 Yeast genetics: markers and strains Specific properties can be quite different and are different to wild or industrial strains The full genotype of W303-1A strain: MATa leu2-3/112 ura3-1 trp1-1 his3-11/15 ade2-1 can1-100 GAL SUC2 mal0 Yeast genetics: crossing strains Cross two haploid strains with different mutations diploid strain Analysis mutations in the same or different genes Sporulation tetrads dissection spores individual colonies 14
15 Yeast genetics: crossing strains Genetic crosses map genes on chromosomes The last genetic map more than 1,000 genes and turned out to be very accurate Today genetic crosses yeast strains with new combination of mutations The genome fully sequenced genetic screens for new mutations Auxotrophy/markers An auxotroph needs a specific substance to grow Auxotrophic genetic markers are often used in molecular genetics HIS3, LEU2, TRP1, URA3, ADE2, and CAN1 Positive and/or negative selection LacZ: transgenic reporter, colony blue colored in X-Gal containing medium upon expression 15
16 Yeast genetics: crossing strains To cross two strains mix on agar plates and allow to mate MATa leu2 URA3 x MATa LEU2 ura3 2n cells will be heterozygous grow on medium lacking both leucine and uracil 2n will be grown and plated on sporulation medium asci/tetrads The ascus wall is digested with a specific enzyme mix spores are separated with a micromanipulator on agar plates Yeast genetics: crossing strains Spores will germinate colonies can be studied individually Properties of the meiotic progeny can be studied directly Pattern of growth how two mutations separate The spore colonies are replicated to different media in order to characterize the properties of the spores and to follow the genetic markers 16
17 Yeast genetics: crossing strains Tetrad Spore MAT leu ura his SUC NaCl 1 A a B alpha C a D alpha A a B a C alpha D alpha
18 The end 18
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
LisätiedotMethods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
Lisätiedot1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
LisätiedotState of the Union... Functional Genomics Research Stream. Molecular Biology. Genomics. Computational Biology
Functional Genomics Research Stream State of the Union... Research Meeting: February 16, 2010 Functional Genomics & Research Report III Concepts Genomics Molecular Biology Computational Biology Genome
LisätiedotSupplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
LisätiedotPlasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
Lisätiedotmake and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
LisätiedotManolis Kellis Piotr Indyk
6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Rapid database search Courtsey of CCRNP, The National Cancer Institute. Manolis Kellis Piotr Indyk Protein interaction network Courtesy
LisätiedotCapacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
LisätiedotExperimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
LisätiedotMALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
LisätiedotOther approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
LisätiedotFETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
LisätiedotSupporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
Lisätiedot16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
LisätiedotInfrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
LisätiedotStrain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC
TABLE S1 Bacterial strains and plasmids Strain or plasmid Description a Reference or source b B. subtilis 168 trpc2 Laboratory stock 1A780 trpc2 sigb::spc BGSC BM1010 trpc2 htpx::pgs1582; Em r BM1302 trpc2
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotEfficient regeneration system and Agrobacteriummediated transformation of Vetiver. PT 1
Efficient regeneration system and Agrobacteriummediated transformation of Vetiver PT www.acolor.net 1 Outline: Part I: Why (Background) Part II: Some concrete work we have done Part III: Prospects to further
LisätiedotFunctional Genomics & Proteomics
Functional Genomics & Proteomics Genome Sequences TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGT CATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACAT
LisätiedotResults on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
LisätiedotEfficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotAlternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
LisätiedotGap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
LisätiedotAYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
Lisätiedotanna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
LisätiedotTilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
LisätiedotChoose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
LisätiedotThe CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
LisätiedotS-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA
S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen
Lisätiedot1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 81122P (4 ov.) 30.5.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
LisätiedotNational Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Lisätiedot7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
LisätiedotKaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä
M a t t i K a t t a i n e n O T M 1 1. 0 9. 2 0 1 9 Kaivostoiminnan eri vaiheiden kumulatiivisten vaikutusten huomioimisen kehittäminen suomalaisessa luonnonsuojelulainsäädännössä Ympäristöoikeustieteen
LisätiedotAjettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
LisätiedotMUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
LisätiedotNetwork to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
LisätiedotSupplementary Information
Supplementary Information Supplementary Table 1. Strain table Strain name Genotype Reference CEN.PK111-27B MATa leu2 trp1 Euroscarf TC-49 TC-50 pdc5::aro4* aro10::aro7* This study TC-50 MATa leu2 trp1
LisätiedotThe Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
LisätiedotInformation on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
LisätiedotInformation on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
LisätiedotLYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
LisätiedotBounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
LisätiedotCounting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X. Rastita Tick (X) (X) the kummassa box that has laatikossa
Lisätiedot812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
LisätiedotFIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
LisätiedotUse of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
LisätiedotSiirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools
Siirtymä maisteriohjelmiin tekniikan korkeakoulujen välillä Transfer to MSc programmes between engineering schools Akateemisten asioiden komitea Academic Affairs Committee 11 October 2016 Eija Zitting
LisätiedotEukaryotic Comparative Genomics
Eukaryotic Comparative Genomics Detecting Conserved Sequences Charles Darwin Motoo Kimura Evolution of Neutral DNA A A T C TA AT T G CT G T GA T T C A GA G T A G CA G T GA AT A GT C T T T GA T GT T G T
LisätiedotSisällysluettelo Table of contents
Sisällysluettelo Table of contents OTC:n Moodlen käyttöohje suomeksi... 1 Kirjautuminen Moodleen... 2 Ensimmäinen kirjautuminen Moodleen... 2 Salasanan vaihto... 2 Oma käyttäjäprofiili... 3 Työskentely
LisätiedotReturns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
LisätiedotViral DNA as a model for coil to globule transition
Viral DNA as a model for coil to globule transition Marina Rossi Lab. of complex fluids and molecular biophysics LITA (Segrate) UNIVERSITA DEGLI STUDI DI MILANO - PhD Workshop October 14 th, 2013 Temperature
LisätiedotGreen Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?
Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille? 10.10.01 Tuomo Suortti Ohjelman päällikkö Riina Antikainen Ohjelman koordinaattori 10/11/01 Tilaisuuden teema Kansainvälistymiseen
LisätiedotTIETEEN PÄIVÄT OULUSSA 1.-2.9.2015
1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti
LisätiedotSärmäystyökalut kuvasto Press brake tools catalogue
Finnish sheet metal machinery know-how since 1978 Särmäystyökalut kuvasto Press brake tools catalogue www.aliko.fi ALIKO bending chart Required capacity in kn (T) in relation to V-opening. V R A S = plates
LisätiedotBLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
UNCITRAL EMERGENCE CONFERENCE 13.12.2016 Session I: Emerging Legal Issues in the Commercial Exploitation of Deep Seabed, Space and AI BLOCKCHAINS AND ODR: SMART CONTRACTS AS AN ALTERNATIVE TO ENFORCEMENT
LisätiedotMiehittämätön meriliikenne
Rolls-Royce & Unmanned Shipping Ecosystem Miehittämätön meriliikenne Digimurros 2020+ 17.11. 2016 September 2016 2016 Rolls-Royce plc The 2016 information Rolls-Royce in this plc document is the property
LisätiedotTutkimusdata ja julkaiseminen Suomen Akatemian ja EU:n H2020 projekteissa
Tutkimusdata ja julkaiseminen Suomen Akatemian ja EU:n H2020 projekteissa Tutkimusasiamies Kaisa Männikkö Tutkimus- ja innovaatiopalvelut Suomen Akatemian projektit Suomen Akatemia kehottaa avoimeen tieteelliseen
LisätiedotInformation on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
LisätiedotTravel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
LisätiedotBasset: Learning the regulatory code of the accessible genome with deep convolutional neural networks. David R. Kelley
Basset: Learning the regulatory code of the accessible genome with deep convolutional neural networks David R. Kelley DNA codes for complex life. How? Kundaje et al. Integrative analysis of 111 reference
LisätiedotStatistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
LisätiedotCS284A Representations & Algorithms for Molecular Biology. Xiaohui S. Xie University of California, Irvine
CS284A Representations & Algorithms for Molecular Biology Xiaohui S. Xie University of California, Irvine Today s Goals Course information Challenges in computational biology Introduction to molecular
LisätiedotCounting quantities 1-3
Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X 2. Rastita Tick (X) (X) the kummassa box that has
LisätiedotELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
LisätiedotSkene. Games Refueled. Muokkaa perustyyl. napsautt. @Games for Health, Kuopio. 2013 kari.korhonen@tekes.fi. www.tekes.fi/skene
Skene Muokkaa perustyyl. Games Refueled napsautt. @Games for Health, Kuopio Muokkaa alaotsikon perustyyliä napsautt. 2013 kari.korhonen@tekes.fi www.tekes.fi/skene 10.9.201 3 Muokkaa Skene boosts perustyyl.
LisätiedotOn instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
LisätiedotPlasmid construction PCR reactions were carried out with Pfu or Pfu turbo polymerases (Stratagene) unless otherwise stated.
Expanding the Genetic Code of Yeast for Incorporation of Diverse Unnatural Amino Acids via a Pyrrolysyl-tRNA Synthetase/tRNA Pair Susan M. Hancock 1, Rajendra Uprety 2, Alexander Deiters 2 & Jason W. Chin
LisätiedotOP1. PreDP StudyPlan
OP1 PreDP StudyPlan PreDP The preparatory year classes are in accordance with the Finnish national curriculum, with the distinction that most of the compulsory courses are taught in English to familiarize
LisätiedotGenome 373: Genomic Informatics. Professors Elhanan Borenstein and Jay Shendure
Genome 373: Genomic Informatics Professors Elhanan Borenstein and Jay Shendure Genome 373 This course is intended to introduce students to the breadth of problems and methods in computational analysis
LisätiedotFinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
LisätiedotConstructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
LisätiedotEUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
LisätiedotRINNAKKAINEN OHJELMOINTI A,
RINNAKKAINEN OHJELMOINTI 815301A, 18.6.2005 1. Vastaa lyhyesti (2p kustakin): a) Mitkä ovat rinnakkaisen ohjelman oikeellisuuskriteerit? b) Mitä tarkoittaa laiska säikeen luominen? c) Mitä ovat kohtaaminen
LisätiedotECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana
ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä
LisätiedotLX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
LisätiedotLataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli Lataa Kirjailija: Pekka Rapeli ISBN: 9789523022232 Sivumäärä: 173 Formaatti: PDF Tiedoston koko: 11.54 Mb Opioid substitution
Lisätiedot4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
LisätiedotKuivajääpuhallus IB 15/120. Vakiovarusteet: Suutinlaatikko Suutinrasva Viuhkasuutin Viuhkasuuttimen irto-osa 8 mm Työkalu suuttimenvaihtoon 2 kpl
Kuivajääpuhallus IB 15/120 Kuivajääpuhallus on nykyaikainen tehokas tapa poistaa erilaista likaa sekä pinnoitteita. Kuivajää hajoaa höyrynä ilmaan, eikä jätä jälkeensä vesi-, hiekka tai muita jäämiä. Vakiovarusteet:
Lisätiedot1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
LisätiedotSalasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
LisätiedotA DEA Game II. Juha Saloheimo S ysteemianalyysin. Laboratorio. Teknillinen korkeakoulu
A DEA Game II Juha Salohemo 12.12.2007 Content Recap of the Example The Shapley Value Margnal Contrbuton, Ordered Coaltons, Soluton to the Example DEA Mn Game Summary Home Assgnment Recap of the Example
LisätiedotIntegration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen
Integration of Finnish web services in WebLicht Presentation in Freudenstadt 2010-10-16 by Jussi Piitulainen Who we are FIN-CLARIN University of Helsinki The Language Bank of Finland CSC - The Center for
LisätiedotInnovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä https://ec.europa.eu/futurium/en/ public-procurement Julkiset hankinnat liittyvät moneen Konsortio Lähtökohdat ja tavoitteet Every
LisätiedotKäyttöliittymät II. Käyttöliittymät I Kertaus peruskurssilta. Keskeisin kälikurssilla opittu asia?
Käyttöliittymät II Sari A. Laakso Käyttöliittymät I Kertaus peruskurssilta Keskeisin kälikurssilla opittu asia? 1 Käyttöliittymät II Kurssin sisältö Käli I Käyttötilanteita Käli II Käyttötilanteet selvitetään
LisätiedotENE-C2001 Käytännön energiatekniikkaa. Aloitustapaaminen 11.4.2016. Osa II: Projekti- ja tiimityö
ENE-C2001 Käytännön energiatekniikkaa Aloitustapaaminen 11.4.2016 Osa II: Projekti- ja tiimityö Sisältö Projektityö Mitä on projektityö? Projektityön tekeminen: ositus, aikatauluhallinta, päätöksenteon
LisätiedotOperatioanalyysi 2011, Harjoitus 2, viikko 38
Operatioanalyysi 2011, Harjoitus 2, viikko 38 H2t1, Exercise 1.1. H2t2, Exercise 1.2. H2t3, Exercise 2.3. H2t4, Exercise 2.4. H2t5, Exercise 2.5. (Exercise 1.1.) 1 1.1. Model the following problem mathematically:
LisätiedotInformation on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
Lisätiedot6.095/ Computational Biology: Genomes, Networks, Evolution. Sequence Alignment and Dynamic Programming
6.095/6.895 - Computational Biology: Genomes, Networks, Evolution Sequence lignment and Dynamic Programming Tue Sept 13, 2005 Challenges in Computational Biology 4 Genome ssembly 5 Regulatory motif discovery
LisätiedotOpiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK
Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK Helppoa/mukavaa/palkitsevaa - easy/nice/rewarding - uudet ystävät/ new friends - koulun
LisätiedotHankkeen toiminnot työsuunnitelman laatiminen
Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa
LisätiedotIncrease of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
LisätiedotTitle: Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae
Title: Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae Authors: Yoichiro Ito, Takao Kitagawa, Mamoru Yamanishi, Satoshi Katahira,
LisätiedotMaster's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.
Master's Programme in Life Science Technologies (LifeTech) Prof. Juho Rousu Director of the Life Science Technologies programme 3.1.2017 Life Science Technologies Where Life Sciences meet with Technology
LisätiedotTarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
LisätiedotMatkustaminen Majoittuminen
- Majoituspaikan löytäminen Where can I find? Ohjeiden kysyminen majoituspaikan löytämiseksi Where can I find?... a room to rent?... a room to rent?... a hostel?... a hostel?... a hotel?... a hotel?...
LisätiedotMatkustaminen Majoittuminen
- Majoituspaikan löytäminen Where can I find? Ohjeiden kysyminen majoituspaikan löytämiseksi... a room to rent?... a hostel?... a hotel?... a bed and breakfast?... a camping site? What are the prices like
LisätiedotFAKE GOLD portfolio OLLIPEKKA KANGAS 2009
FAKE GOLD portfolio OLLIPEKKA KANGAS 2009 Ollipekka Kangas in short Ollipekka Kangas was born in 1965 in Riihimäki. He graduated as art teacher in 1997 and Master of Arts two years later from the University
LisätiedotSmall Number Counts to 100. Story transcript: English and Blackfoot
Small Number Counts to 100. Story transcript: English and Blackfoot Small Number is a 5 year-old boy who gets into a lot of mischief. He lives with his Grandma and Grandpa, who patiently put up with his
Lisätiedot