AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY

Koko: px
Aloita esitys sivulta:

Download "AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY"

Transkriptio

1 T070 Liite 1.05 / Appendix 1.05 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY YHTYNEET MEDIX LABORATORIOT OY UNITED MEDIX LABORATORIES LTD Tunnus Code Yksikkö tai toimintoala Department or section of activity Osoite Address www www T070, liite 1.05 Yhtyneet Medix Laboratoriot Oy Kivihaantie HELSINKI T070, App United Medix Laboratories Ltd Kivihaantie 7 FI HELSINKI FINLAND Testausalat Fields of testing Kliininen testaus Clinical testing

2 T070 Liite 1.05 / Appendix 1.05 Sivu / Page 2(5) Kliininen testaus, Clinical testing,, korionvillus, lapsivesi, chorionic villus, amniotic fluid, poskisolu, lapsivesi, korionvillus, istukkakudos, ihokudos, mucosa cells, anmiotic fluid, chorionic villus, placental tissue, skin Alfa-1 antirypsiinin genotyypitys, B -AtryTyD, KL 4500 Alpha-1-antirypsin, DNA Apolipoproteiini E, DNAtutkimus B -ApoE-D, KL 4092 Apolipoprotein E, DNA B Fragiili-X, -FMR1 geenin B FraX-D, KL 4112 Ts-Fragiili-X, FMR1 geenin Ts-FraX-D, KL 4306 Fragile X syndrome, FMR1 gene CGG trinucleotide repeat expansion Genomisen DNA:n eristys -DNAex, KL 4209 Extraction of Genomic DNA -DNAex, KL 4209 Hemokromatoosi, DNAtutkimus B Hemok-D, KL 1858 Hemochromatosis, DNA Hyytymistekijä V-geeni, B -FV-D, KL 4410 Coagulation factorv, DNA Genotyyppitutkimus PCR+geelielektroforeesi Genotype PCR+gel electrophoresis FMR1 geenin CGG trinukleotidi toistojakson RP (repeat primed) PCR ja fragmenttianalyysi FMR1 gene CGG trinucleotide repeat RP (repeat primed) PCR and fragment length Solujen hajotus, DNA:n puhdistus (pylväs/saostus/ magneettierottelu), DNA:n eluutio/liuotus Cell lysis, DNA purification (column/precipitation/ magnetic separation), DNA elution/dissolving

3 T070 Liite 1.05 / Appendix 1.05 Sivu / Page 3(5), poskisolut, mucosa cells JAK2-geenin mutaatio, B JAK2-D, KL 4952 JAK2 gene mutation, DNA Keliakian HLA-tautiassosiaatio, B -HLAKeli, KL 4640 HLA association in coeliac diseace, DNA Kudosantigeeni B27, DNAtutkimus Ly-HLAB27, KL 3075 Tissue antigen, DNA blood Laktoosi-intoleranssi, DNAtutkimus B -Lakt-D, KL 4614 Mu-Lakt-D, KL 6333 Adult-type hypolactasia, DNA LDL-reseptorigeenin mutaatio, B -LDLRe-D, KL 3865 LDL receptor gene mutation, DNA Protrombiinigeeni, DNAtutkimus B FII-D, KL 1920 Protrombin gene, DNA Y-kromosomin mikrodeleetio, B -Ykrom-D, KL 1783 Microdeletion of the Y- chromosome DNA PCR ja geelielektroforeesi PCR and gel electrophoresis SYBR green kemiaa käyttäen Real time PCR using SYBR green PCR ja restriktioentsyymidigestio + geelielektroforeesi ja reaaliaikainen PCR Taqman kemiaa käyttäen PCR and restriction enzyme digestion + gel electrophoresis and real time PCR using Taqman PCR+geelielektroforeesi DNA study, PCR +gel electrophoresis

4 T070 Liite 1.05 / Appendix 1.05 Sivu / Page 4(5) Luuydin, hepariiniveri tai kudos Bone marrow, heparin blood or tissue Kantasolut Stem cells Lapsivesi Amniotic fluid Istukkanäyte Chorionic villi Kiinteä kudos Solid tissue, lapsivesi, luuydin, blastomeeri, amniotic fluid, bone marrow, blastomere verestä B -Kromos, KL 2151 Chromosome, blood, hematologisissa sairauksissa Bm-KromHem, KL 2152 B -KromHem, KL 4551 Ts-KromHem, KL 4552 Chromosome, hematological kantasoluista Sc-Kromos, ATK 9253 Chromosome study, stem cells Sikiön kromosomitutkimus Am-Kromos, KL 2150 Fetal Chromosome Study Sikiön kromosomitutkimus Cv-Kromos, KL 3641 Fetal Chromosome Study, kiinteä kudos Ts-Kromos, KL 3741 Chromosome, solid tissue Kromosomien FISH-tutkimus Chromosome FISH study G-raitavärjäysmenetelmä Chromosome using G-banding G-raitavärjäysmenetelmä Chromosome using G-banding Fluoresenssi in situ hybridisaatio Fluorescence in situ hybridization

5 T070 Liite 1.05 / Appendix 1.05 Sivu / Page 5(5) Lapsivesi, veri, korionvillus, kudos Amniotic fluid, blood, chorionic villus, tissue Kohdennettu trisomia- ja mikrodeleetiotutkimus Am-TriMdel, KL 6223 B TriMdel, KL 6224 Cv-TriMdel, KL 6225 Ts-TriMdel, KL 6226 Targeted trisomy and microdeletion study Molekyylikaryotyypitys, synnynnäiset poikkeavuudet B MKsyn, KL 6220 Molecular karyotyping, constitutional abnormalities Luminex-teknologia, PNBoBs kitti (PE) Luminex technology, PNBoBs kit (PE) Mikrosiru-teknologia Micro-array (array CGH)

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY T013 Liite 1.03 / Appendix 1.03 Sivu / Page 1(8) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY TYÖTERVEYSLAITOS, ASIAKASRATKAISUT FINNISH INSTITUTE OF OCCUPATIONAL HEALTH, CLIENT SERVICES

Lisätiedot

VTT EXPERT SERVICES OY

VTT EXPERT SERVICES OY T001 Liite 1.08 / Appendix 1.08 Sivu / Page 1(6) VTT EXPERT SERVICES OY VTT EXPERT SERVICES LTD. Tunnus Code Yksikkö tai toimintoala Department or section of activity Osoite Address Puh./fax/e-mail/www

Lisätiedot

AKKREDITOITU VERTAILUMITTAUSJÄRJESTÄJÄ ACCREDITED PROFICIENCY TESTING PROVIDER

AKKREDITOITU VERTAILUMITTAUSJÄRJESTÄJÄ ACCREDITED PROFICIENCY TESTING PROVIDER 1(10) AKKREDITOITU VERTAILUMITTAUSJÄRJESTÄJÄ ACCREDITED PROFICIENCY TESTING PROVIDER LABQUALITY OY ULKOISET LAADUNARVIOINTIPALVELUT PT02 (EN ISO/IEC 17043) LABQUALITY LTD. EXTERNAL QUALITY ASSESSMENT SERVICES

Lisätiedot

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi

Annika Rökman. sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Annika Rökman sovellusasiantuntija, FT, sairaalegeneetikko, datanomi Oma taustani FM genetiikka 1998 sairaalageneetikko 2004 FT Perinnöllisestä eturauhassyövästä 2004 Finaksen teknisenä arvioijana vuodesta

Lisätiedot

Soluhoitovalmisteet ja määräys yksittäisten potilaiden hoidosta. matti korhonen 12.1.2010

Soluhoitovalmisteet ja määräys yksittäisten potilaiden hoidosta. matti korhonen 12.1.2010 Soluhoitovalmisteet ja määräys yksittäisten potilaiden hoidosta matti korhonen 12.1.2010 Sisältö Veripalvelu ja uudet soluhoidot määräys nostaa rimaa eri tyyppiset soluhoidot määräyksen soveltaminen 'Yksittäisen

Lisätiedot

Sikiön kehityshäiriöiden seulonta alkuraskaudessa

Sikiön kehityshäiriöiden seulonta alkuraskaudessa Sikiön kehityshäiriöiden seulonta alkuraskaudessa Sikiön 21-trisomian seulonta äidin verinäytteestä ensimmäisen raskauden kolmanneksen aikana (raskausviikot 11.-12.) (S -Tr1Seul no 4548) Yleistä Raskauksien

Lisätiedot

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia

9/30/2013. GMO analytiikka. Termistöä. Markkinoilla olevien GM kasvien ominaisuuksia GMO analytiikka Kemian ja toksikologian tutkimusyksikkö Evira Termistöä geenimuuntelu muuntogeeninen siirtogeeninen GM GMO (geneettisesti muunnettu organismi) GM tapahtuma (event): käytetään silloin kun

Lisätiedot

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY T113/M17/2015 Liite 1 / Appendix 1 Sivu / Page 1(28) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY POHJOIS-SUOMEN LABORATORIOKESKUKSEN LIIKELAITOSKUNTAYHTYMÄ (NORDLAB), OULUN ALUELABORATORIO

Lisätiedot

Miller-Diekerin oireyhtymä

Miller-Diekerin oireyhtymä Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. Miller-Diekerin oireyhtymä Lääkäri

Lisätiedot

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa

Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit apuna lääkehoidon arvioinnissa Farmakogeneettiset testit Farmakogenetiikalla tarkoitetaan geneettisiä variaatioita, jotka vaikuttavat lääkeainevasteeseen. Geneettisen tiedon hyödyntäminen

Lisätiedot

RhD-negatiivisten äitien suojaus raskauden aikana

RhD-negatiivisten äitien suojaus raskauden aikana RhD-negatiivisten äitien suojaus raskauden aikana Valtakunnalliset Neuvolapäivät 9.10.2013 Susanna Sainio SPR Veripalvelu 1 1 1 1 1 Raskausimmunisaation syntymekanismi fetomaternaalivuoto FMH: 1. trim.

Lisätiedot

TOIMINTAKERTOMUS 1.1. - 31.12.2003

TOIMINTAKERTOMUS 1.1. - 31.12.2003 Suomen kliinisen kemian yhdistys Föreningen för klinisk kemi i Finland TOIMINTAKERTOMUS 1.1. - 31.12.2003 YHDISTYKSEN TOIMIHENKILÖT Johtokunta 2003 Puheenjohtaja Varapuheenjohtaja Sihteeri Rahastonhoitaja

Lisätiedot

EBM ja laboratorio. Kristina Hotakainen HY ja HUSLAB

EBM ja laboratorio. Kristina Hotakainen HY ja HUSLAB EBM ja laboratorio Kristina Hotakainen HY ja HUSLAB EBLM Arvioidaan laboratoriokokeiden vaikutuksia kliiniseen päätöksentekoon ja potilaan hoitotuloksiin mm. kliinistä epidemiologiaa, tilastotiedettä,

Lisätiedot

Istukkagonadotropiini (hcg) - enemmän kuin raskaushormoni. Kristina Hotakainen, LT. Kliinisen kemian yksikkö Helsingin yliopisto ja HUSLAB

Istukkagonadotropiini (hcg) - enemmän kuin raskaushormoni. Kristina Hotakainen, LT. Kliinisen kemian yksikkö Helsingin yliopisto ja HUSLAB Istukkagonadotropiini (hcg) - enemmän kuin raskaushormoni Kristina Hotakainen, LT. Kliinisen kemian yksikkö Helsingin yliopisto ja HUSLAB Istukkagonadotropiini (Human Chorionic Gonadotropin, hcg) Kuuluu

Lisätiedot

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio

NGS:n haasteet diagnostiikassa. 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio NGS:n haasteet diagnostiikassa 9.10.2014 Soili Kytölä, dos. sairaalageneetikko HUSLAB, genetiikan laboratorio Sidonnaisuudet Kokousmatkoja: Novartis Luentopalkkioita: AstraZeneca, Roche, Pfizer, Lilly

Lisätiedot

Valtakunnallinen koulutuskoordinaattori: dosentti Päivi Lähteenmäki. Koulutusohjelman vastuuhenkilö ja kuulustelija: Dosentti Päivi Lähteenmäki

Valtakunnallinen koulutuskoordinaattori: dosentti Päivi Lähteenmäki. Koulutusohjelman vastuuhenkilö ja kuulustelija: Dosentti Päivi Lähteenmäki LASTENHEMATOLOGIAN JA -ONKOLOGIAN LISÄKOULUTUSOHJELMA Valtakunnallinen koulutuskoordinaattori: dosentti Päivi Lähteenmäki Koulutusohjelman vastuuhenkilö ja kuulustelija: Dosentti Päivi Lähteenmäki Koulutusohjelman

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä

Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä Bakteeriperäisen turistiripulin diagnostiikka nukleiinihaponosoitusmenetelmillä Sointu Mero HUSLAB 5.2.2015 Labquality Days Luennon sisältöä: matkailutaustaa ulosteen bakteeriviljely nukleiinihaponosoitusmenetelmät

Lisätiedot

SÄTEILYN GENEETTISET VAIKUTUKSET

SÄTEILYN GENEETTISET VAIKUTUKSET 8 SÄTEILYN GENEETTISET VAIKUTUKSET Sisko Salomaa SISÄLLYSLUETTELO 8.1 Ihmisen perinnölliset sairaudet... 122 8.2 Perinnöllisten sairauksien taustailmaantuvuus... 125 8.3 Perinnöllisen riskin arviointi...

Lisätiedot

SPR Veripalvelussa tehtävät kudossopeutuvuus-, tautiassosiaatio- ja leukosyyttivasta-ainetutkimukset muuttuvat atk-välitteisiksi 10.12.

SPR Veripalvelussa tehtävät kudossopeutuvuus-, tautiassosiaatio- ja leukosyyttivasta-ainetutkimukset muuttuvat atk-välitteisiksi 10.12. TUTKIMUSTIEDOTE 2013:60 HELSINGIN JA UUDENMAAN SAIRAANHOITOPIIRI 3.12.2013 Kliininen kemia ja hematologia SPR Veripalvelussa tehtävät kudossopeutuvuus-, tautiassosiaatio- ja leukosyyttivasta-ainetutkimukset

Lisätiedot

Suomen GLP-ohjelma ja Fimean GLPtarkastukset. Pirkko Puranen, ylitarkastaja Lääkealan toimijoiden valvonta

Suomen GLP-ohjelma ja Fimean GLPtarkastukset. Pirkko Puranen, ylitarkastaja Lääkealan toimijoiden valvonta Suomen GLP-ohjelma ja Fimean GLPtarkastukset Pirkko Puranen, ylitarkastaja Lääkealan toimijoiden valvonta GLP säädökset ja ohjeet OECD - Mutual Acceptance of Data (MAD-sopimus), tiedon vastavuoroinen hyväksyntä

Lisätiedot

SPR Veripalvelu. Soluterapian haasteet. Saara Laitinen, Solututkimuslaboratorio, Tutkimus ja tuotekehitys. www.veripalvelu.fi. www.veripalvelu.

SPR Veripalvelu. Soluterapian haasteet. Saara Laitinen, Solututkimuslaboratorio, Tutkimus ja tuotekehitys. www.veripalvelu.fi. www.veripalvelu. SPR Veripalvelu Soluterapian haasteet Saara Laitinen, Solututkimuslaboratorio, Tutkimus ja tuotekehitys 1 1 11 1 Joka vuosi SPR Veripalvelu: 270.000 verenluovutusta 70-90 välitettyä kantasolusiirrettä

Lisätiedot

Lapsivesitutkimus. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Lapsivesitutkimus. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Lapsivesitutkimus Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy s and St Thomas Hospital, London, United Kingdom; the Royal College of Obstetricians

Lisätiedot

Sikiön 21-trisomian seulontakeinot. Mervi Päkkilä, Marko Niemimaa, Pertti Kirkinen ja Markku Ryynänen

Sikiön 21-trisomian seulontakeinot. Mervi Päkkilä, Marko Niemimaa, Pertti Kirkinen ja Markku Ryynänen Katsaus Sikiön 21-trisomian seulontakeinot Mervi Päkkilä, Marko Niemimaa, Pertti Kirkinen ja Markku Ryynänen Sikiödiagnostiikan seulontatutkimukset tulevat siirtymään ensimmäiselle raskauskolmannekselle,

Lisätiedot

LABVANTAGE Medical Suite LIMS Digitaalisen Patologian Tukena Jani Aho Myynti ja Markkinointipäällikkö

LABVANTAGE Medical Suite LIMS Digitaalisen Patologian Tukena Jani Aho Myynti ja Markkinointipäällikkö LABVANTAGE Medical Suite LIMS Digitaalisen Patologian Tukena Jani Aho Myynti ja Markkinointipäällikkö Your Local lims partner Finland Sweden Norway - Denmark Your Local lims partner Finland Sweden Norway

Lisätiedot

PCR:n laadunvarmistus. Saija Hallanvuo Elintarvike- ja rehumikrobiologian tutkimusyksikkö/ Elintarvikemikrobiologiajaosto

PCR:n laadunvarmistus. Saija Hallanvuo Elintarvike- ja rehumikrobiologian tutkimusyksikkö/ Elintarvikemikrobiologiajaosto PCR:n laadunvarmistus Saija Hallanvuo Elintarvike- ja rehumikrobiologian tutkimusyksikkö/ Elintarvikemikrobiologiajaosto Ajankohtaista laboratoriorintamalla 11.10.2012 1 Laadunvarmistus Validointi Henkilökunnan

Lisätiedot

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin.

Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. 1. Pääryhmien ominaispiirteitä Tarkastele kuvaa, muistele matematiikan oppejasi, täytä tekstin aukot ja vastaa kysymyksiin. Merkitse aukkoihin mittakaavan tuttujen yksiköiden lyhenteet yksiköitä ovat metri,

Lisätiedot

FIMM Technology Services FIMM:n teknologiapalvelut 1

FIMM Technology Services FIMM:n teknologiapalvelut 1 FIMM Technology Services FIMM:n teknologiapalvelut 1 3 Overview 6 Genomic Profiling 8 Gene Expression Analyses 9 DNA Methylation Analyses 10 smallrna Sequencing and Screening 11 Metabolomics 12 Cell-based

Lisätiedot

Mitä on moderni biopankkitoiminta?

Mitä on moderni biopankkitoiminta? Mitä on moderni biopankkitoiminta? LabQuality-päivät 9.2.2012 Kimmo Pitkänen kehittämispäällikkö Suomen molekyylilääketieteen instituutti FIMM FIMM - Institute for Molecular Medicine Finland 1) Mikä on

Lisätiedot

Miten biopankkitoiminta vaikuttaa patologian osastoissa

Miten biopankkitoiminta vaikuttaa patologian osastoissa Miten biopankkitoiminta vaikuttaa patologian osastoissa Markku Kallajoki TYKS-SAPA/patologia ja Auria Biopankki Labquality days 6.2. 2015 Sisältö Motivointi Biopankkilaki Tuorenäytekeräys Arkistotoimi

Lisätiedot

ASh 2007 kongressiraportti The AmericAn SocieTy of hematology AnnuAl meeting 8. 11.12.2007 ATlAnTA, georgia, usa

ASh 2007 kongressiraportti The AmericAn SocieTy of hematology AnnuAl meeting 8. 11.12.2007 ATlAnTA, georgia, usa ASH 2007 kongressiraportti The American Society of Hematology Annual Meeting 8. 11.12.2007 Atlanta, Georgia, USA ASH 2007 -kongressiraportti Julkaisija: Novartis Finland Oy, Metsänneidonkuja 10, 02130

Lisätiedot

Sikiöseulonnat OPAS RASKAANA OLEVILLE. Tietoa sikiön kromosomi- ja rakennepoikkeavuuksien seulonnoista

Sikiöseulonnat OPAS RASKAANA OLEVILLE. Tietoa sikiön kromosomi- ja rakennepoikkeavuuksien seulonnoista Tämä esite on tarkoitettu kaikille raskaana oleville. Vanhempien toivotaan tutustuvan esitteeseen yhdessä. Sikiö seulontoihin osallistuminen on vapaaehtoista. Sikiöseulonnat OPAS RASKAANA OLEVILLE Tietoa

Lisätiedot

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa

Lisätiedot

SOLUVILJELY- TEEMANUMEROSSA MM.

SOLUVILJELY- TEEMANUMEROSSA MM. Science whereyou are Tarjoukset voimassa 30.6.2014 asti kampanjakoodilla FIN300614FIN. Kampanjahinnat ilman arvonlisäveroa. SOLUVILJELY- TEEMANUMEROSSA MM. CST:n IF-validoidut vasta-aineet ja leimatut

Lisätiedot

Viime vuosisadan alkupuolella arveltiin, että

Viime vuosisadan alkupuolella arveltiin, että Elin- ja kudossiirrot Kimmo Porkka ovat tulossa kliinisen käyttöön. Jo nyt hematopoieettisten kantasolujen siirto on monien veritautien käypää hoitoa. Jopa 80 % potilaista paranee näiden siirtojen avulla

Lisätiedot

AKKREDITOITU SERTIFIOINTIELIN ACCREDITED CERTIFICATION BODY VTT EXPERT SERVICES OY

AKKREDITOITU SERTIFIOINTIELIN ACCREDITED CERTIFICATION BODY VTT EXPERT SERVICES OY S017 Liite 1.01 / Appendix 1.01 Sivu / Page 1(6) AKKREDITOITU SERTIFIOINTIELIN ACCREDITED CERTIFICATION BODY VTT EXPERT SERVICES OY VTT EXPERT SERVICES LTD. Tunnus Code Yksikkö tai toimintoala Department

Lisätiedot

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395

X-kromosominen periytyminen. Potilasopas. TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 12 X-kromosominen periytyminen TYKS Perinnöllisyyspoliklinikka PL 52, 20521 Turku puh (02) 3131 390 faksi (02) 3131 395 FOLKHÄLSANS GENETISKA KLINIK PB 211, (Topeliusgatan 20) 00251 Helsingfors tel (09)

Lisätiedot

Seulontavaihtoehdot ja riskit

Seulontavaihtoehdot ja riskit Seulontavaihtoehdot ja riskit Hannele Laivuori HUSLAB Perinnöllisyyslääketieteen yksikkö Jaakko Ignatius TYKS, Perinnöllisyyslääketiede Finohta / Sikiöseulontojen yhtenäistäminen / Hannele Laivuori ja

Lisätiedot

Jukka Hytönen Kliinisen mikrobiologian erikoislääkäri UTULab Bakteeriserologia

Jukka Hytönen Kliinisen mikrobiologian erikoislääkäri UTULab Bakteeriserologia Bordetella pertussis Laboratorion näkökulma Jukka Hytönen Kliinisen mikrobiologian erikoislääkäri UTULab Bakteeriserologia SIDONNAISUUDET Asiantuntija Labquality Ammatinharjoittaja Mehiläinen Apurahoja:

Lisätiedot

Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO

Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Paikkatiedon semanttinen mallinnus, integrointi ja julkaiseminen Case Suomalainen ajallinen paikkaontologia SAPO Tomi Kauppinen, Eero Hyvönen, Jari Väätäinen Semantic Computing Research Group (SeCo) http://www.seco.tkk.fi/

Lisätiedot

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi

Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Laskuharjoitus 4 selitykset Juha-Matti Alakoskela, jmalakos@cc.helsinki.fi Tehtävä 1: Solusykli, 0 9 p. Etsi oppikirjasta (ainakin Lehningeristä ja Albertsista löytyy) tai verkosta kuva solusyklistä (cell

Lisätiedot

Virusten esiintyminen ravintolatilojen pinnoilla. Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 4.

Virusten esiintyminen ravintolatilojen pinnoilla. Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 4. Virusten esiintyminen ravintolatilojen pinnoilla Leena Maunula, Elintarvikehygienian ja ympäristöterveyden osasto, ELTDK, HY 25. 4. 2013 Eläinlääketieteellinen tiedekunta / Leena Maunula 6.5.2013 1 Pintanäytetutkimukset

Lisätiedot

Verivalmisteita täsmälliseen verensiirtotarpeeseen

Verivalmisteita täsmälliseen verensiirtotarpeeseen tieteessä Eeva Juvonen dosentti, kliinisen hematologian erikoislääkäri eeva.juvonen@veripalvelu.fi Inna Sareneva FM, veriryhmäasiantuntija Tom Krusius professori, lääketieteellinen johtaja Suomen Punainen

Lisätiedot

update PlatR Minimoi pipetointivirheitä ohjelmoidulla pipetoinnilla. Katso sivu 6. Uusi toimittaja! Täysautomaattinen ja avoin ELISAinstrumentti.

update PlatR Minimoi pipetointivirheitä ohjelmoidulla pipetoinnilla. Katso sivu 6. Uusi toimittaja! Täysautomaattinen ja avoin ELISAinstrumentti. SYKSY 2013 update Uusi toimittaja! Täysautomaattinen ja avoin ELISAinstrumentti. Katso sivu 6. UUTUUS Glite 900BW! Markkinoiden pienin geelinkuvantamislaite. Katso sivu 2. Vuoden hinta Mx3005P Real-Time

Lisätiedot

GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus

GENOMINEN VALINTA HEVOSJALOSTUKSESSA. Markku Saastamoinen MTT Hevostutkimus GENOMINEN VALINTA HEVOSJALOSTUKSESSA Markku Saastamoinen MTT Hevostutkimus Genominen valinta genomisessa valinnassa eläimen jalostusarvo selvitetään DNA:n sisältämän perintöaineksen tiedon avulla Genomi

Lisätiedot

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio:

epiteeli endodermi Nisäkkään hampaan kehitys nisäkkään alkio: -mesenkyymi-vuorovaikutukset, esimerkkinä hammas ja ihokarva elimiä muodostuu kaikista alkiokerroksista, usein epiteelin ja mesenkyymin vuorovaikutuksesta epiteeli ektodermi kumpi aloittaa elimen kehityksen:

Lisätiedot

Ihmisen varaosat. Studia Generalia Lahtiensis 22.03.2011 Kimmo Kontula, HY:n vararehtori Sisätautiopin professori

Ihmisen varaosat. Studia Generalia Lahtiensis 22.03.2011 Kimmo Kontula, HY:n vararehtori Sisätautiopin professori Ihmisen varaosat Studia Generalia Lahtiensis 22.03.2011 Kimmo Kontula, HY:n vararehtori Sisätautiopin professori Daidalos ja Ikaros C.P. Landon 1799 Pyhä Kosmas ja Pyhä Damian (t 287 jkr) suorittamassa

Lisätiedot

Sikiöseulonnan jatkotutkimukset

Sikiöseulonnan jatkotutkimukset Tämä esite on tarkoitettu perheille, joissa raskausajan seulontojen perusteella epäillään sikiön poikkeavuutta. Kaikkiin jatkotutkimuksiin osallistuminen on vapaaehtoista. Sikiöseulonnan jatkotutkimukset

Lisätiedot

? LUCA (Last universal common ancestor) 3.5 miljardia v.

? LUCA (Last universal common ancestor) 3.5 miljardia v. Mitä elämä on? - Geneettinen ohjelma, joka kykenee muuttamaan ainehiukkaset ja molekyylit järjestyneeksi itseään replikoivaksi kokonaisuudeksi. (= geneettistä antientropiaa) ? LUCA (Last universal common

Lisätiedot

Normaalimikrobiston uusi tuleminen

Normaalimikrobiston uusi tuleminen PEOPLE ARE NOT JUST PEOPLE. THEY ARE AN AWFUL LOT MICROBES, TOO (The Economist 2012) Normaalimikrobiston uusi tuleminen FM Eveliina Munukka Projektitutkija 3.10.2014 Lee & Mazmanian, Science 2010 NORMAALIMIKROBISTON

Lisätiedot

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa

T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa T-61.246 Digitaalinen signaalinkäsittely ja suodatus Tutkielma Signaalinkäsittely DNA-mikrosiruteknologiassa Liisa-Ida Sorsa, 58714E Sisällysluettelo i SISÄLLYSLUETTELO 1JOHDANTO... 1 2BIOLOGIAA DNA-MIKROSIRUTEKNOLOGIALLA...

Lisätiedot

GEENIT JA KORONAARITAUDIN RISKI

GEENIT JA KORONAARITAUDIN RISKI GEENIT JA KORONAARITAUDIN RISKI LT Kirsi Auro 17/10/2013 1 Aiheet Sydän- ja verisuonitautien preventiosta Suomessa Geneettiset riskilaskut Loppupäätelmät Sydän- ja verisuonitautien riskitekijöitä Sukupuoli

Lisätiedot

VÄESTÖLIITON PERINNÖLLISYYSKLINIKKA, TIETOLEHTISET/ NOONANIN OIREYHTYMÄ

VÄESTÖLIITON PERINNÖLLISYYSKLINIKKA, TIETOLEHTISET/ NOONANIN OIREYHTYMÄ Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. Noonanin oireyhtymä Lääkäri Kristiina

Lisätiedot

Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa

Lisätiedot

Anemian diagnostiikka mitä saan selville mikroskoopilla? Pirkko Lammi Kl. kem. erikoislääkäri ISLAB

Anemian diagnostiikka mitä saan selville mikroskoopilla? Pirkko Lammi Kl. kem. erikoislääkäri ISLAB Anemian diagnostiikka mitä saan selville mikroskoopilla? Pirkko Lammi Kl. kem. erikoislääkäri ISLAB ANEMIA Anemia = Hb laskee alle iän ja sukupuolen mukaisen viitearvon Anemian syntymekanismit Punasolujen

Lisätiedot

sosiaaliturvatunnus Tehtävissä tarvittavia atomipainoja: hiili 12,01; vety 1,008; happi 16,00. Toisen asteen yhtälön ratkaisukaava: ax 2 + bx + c = 0;

sosiaaliturvatunnus Tehtävissä tarvittavia atomipainoja: hiili 12,01; vety 1,008; happi 16,00. Toisen asteen yhtälön ratkaisukaava: ax 2 + bx + c = 0; Valintakoe 2012 / Biokemia Nimi sosiaaliturvatunnus Tehtävissä tarvittavia atomipainoja: hiili 12,01; vety 1,008; happi 16,00. Toisen asteen yhtälön ratkaisukaava: ax 2 + bx + c = 0; 1. Kuvassa on esitetty

Lisätiedot

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY

VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY VALINTAKOE 2014 Terveyden biotieteiden koulutusohjelmat/ty ja ISY BIOLOGIAN KYSYMYSTEN Hyvän vastauksen piirteet 2014 Väittämätehtävät. Maksimipisteet 10. Määrittele tai kuvaa lyhyesti seuraavat termit.

Lisätiedot

HIV-potilaan raskauden seuranta. Elina Korhonen, kätilö HYKS, Naistenklinikka

HIV-potilaan raskauden seuranta. Elina Korhonen, kätilö HYKS, Naistenklinikka HIV-potilaan raskauden seuranta Elina Korhonen, kätilö HYKS, Naistenklinikka Naistenklinikan HIVpoliklinikka raskauden seuranta tapahtuu keskitetysti NKL:n äitiyspoliklinikalla erikoislääkäri Marja Kaijomaa

Lisätiedot

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45

Hyvän vastauksen piirteet. Biolääketieteen valintakoe 20.05.2015. Maksimipisteet: 45 Hyvän vastauksen piirteet Biolääketieteen valintakoe 20.05.2015 Maksimipisteet: 45 I) Monivalintakysymykset. Rengasta oikea vaihtoehto. Vain yksi vaihtoehdoista on oikein. Vastaus on hylätty, jos on rengastettu

Lisätiedot

18-rengaskromosomi-oireyhtymä

18-rengaskromosomi-oireyhtymä Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. 18-rengaskromosomi-oireyhtymä Perinnöllisyyslääketieteen

Lisätiedot

Veri ja elimistön puolustus. Kappaleet 19 ja 22, Tortora 12ed

Veri ja elimistön puolustus. Kappaleet 19 ja 22, Tortora 12ed Veri ja elimistön puolustus Kappaleet 19 ja 22, Tortora 12ed Veren kloostumus Verisolujen tuotanto Punasolut Verihiutaleet ja hyytyminen Veri on nestemäistä kudosta Composition of Blood Water Amino acids

Lisätiedot

Kaikki kimot sukua yhdelle alkukimolle

Kaikki kimot sukua yhdelle alkukimolle Teksti ja kuvat: Johanna Viitanen Hevosen värikartta Hevosen värikartta tarkentuu vuosi vuodelta. Uusia DNA-testejä tulee markkinoille vuosittain. Värit raivaavat polkuja myös terveyttä, sairauksia ja

Lisätiedot

LABQUALITY DAYS 6.-7.2.2014 HEIDI NOUSIAINEN. 2/11/2014 Heidi Nousiainen 1

LABQUALITY DAYS 6.-7.2.2014 HEIDI NOUSIAINEN. 2/11/2014 Heidi Nousiainen 1 LABQUALITY DAYS 6.-7.2.2014 HEIDI NOUSIAINEN 1 KIRJALLISUUSKATSAUS: NÄYTTEIDEN SÄILYTYSLÄMPÖTILAT TAVALLISIMMISSA HORMONITUTKIMUKSISSA erikoistuva kemisti Heidi Nousiainen HUSLAB 2 STANDARDI SFS-EN ISO

Lisätiedot

Ennenaikaiseen synnytykseen ja kohdunsisäiseen infektioon liittyvien merkkiaineiden määrittäminen potilasnäytteistä

Ennenaikaiseen synnytykseen ja kohdunsisäiseen infektioon liittyvien merkkiaineiden määrittäminen potilasnäytteistä Anna Kärkkäinen Ennenaikaiseen synnytykseen ja kohdunsisäiseen infektioon liittyvien merkkiaineiden määrittäminen potilasnäytteistä Opinnäytetyö Metropolia Ammattikorkeakoulu Terveys ja hoitaminen Bioanalyytikko

Lisätiedot

NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ MAHTAVAT CST-KAMPANJAT!

NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ MAHTAVAT CST-KAMPANJAT! Science whereyou are Tarjoukset voimassa 30.10.2014 asti kampanjakoodilla FIN301014FIN. Kampanjahinnat ilman arvonlisäveroa. NYT MEILTÄ MYÖS LONZAN JA GREINERIN LAATUTUOTTEET MM. SOLUVILJELYYN! HYÖDYNNÄ

Lisätiedot

Piia-Riikka Pippola, Asta Viljanen. ABO-veriryhmän alatyyppien genotyypitysmenetelmän koestus. Metropolia Ammattikorkeakoulu.

Piia-Riikka Pippola, Asta Viljanen. ABO-veriryhmän alatyyppien genotyypitysmenetelmän koestus. Metropolia Ammattikorkeakoulu. Piia-Riikka Pippola, Asta Viljanen ABO-veriryhmän alatyyppien genotyypitysmenetelmän koestus Metropolia Ammattikorkeakoulu Bioanalyytikko Bioanalytiikan koulutusohjelma Opinnäytetyö 30.10.2014 Tiivistelmä

Lisätiedot

UPDATE SYKSY 2015. DeNovix uutuus! Mikrotilavuus spektrofotometri ja fluorometri yhdessä ja samassa laitteessa Katso sivu 3

UPDATE SYKSY 2015. DeNovix uutuus! Mikrotilavuus spektrofotometri ja fluorometri yhdessä ja samassa laitteessa Katso sivu 3 SYKSY 2015 UPDATE DeNovix uutuus! Mikrotilavuus spektrofotometri ja fluorometri yhdessä ja samassa laitteessa Katso sivu 3 Azure Imaging System Kemiluminesenssi-detektio: vaihtoehto pimeähuoneelle Katso

Lisätiedot

JUMALAN OLEMASSAOLOA. En voinut enää kieltää

JUMALAN OLEMASSAOLOA. En voinut enää kieltää A E l JUMALAN OLEMASSAOLOA V jl l l j Igl j l l l M j l l j M l l? K ö ljl p j pö l j pl j lpp Ol g l j lppj lp M j l j lblg Rc Dw j l H l pjl l l p l j DNA: j l l l S pl J l p l l l l M ö j lppj lp pl

Lisätiedot

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY

AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY T131/M23/2015 Liite 1 / Appendix 1 Sivu / Page 1(19) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY AHMA YMPÄRISTÖ OY, LABORATORIOT JA NÄYTTEENOTTO AHMA ENVIRONMENT LTD, LABORATORIES AND

Lisätiedot

FINAS - akkreditointipalvelu. Espoo 2012 ISBN 978-952-5610-87-1

FINAS - akkreditointipalvelu. Espoo 2012 ISBN 978-952-5610-87-1 Periaatteet laboratorioiden laadunvarmistusja FINAS - akkreditointipalvelu Espoo 2012 ISBN 978-952-5610-87-1 1(6) Periaatteet laboratorioiden laadunvarmistusja Alkusanat Tämän FINAS-akkreditointipalvelun

Lisätiedot

Mitä laboratorion hyytymiskokeet kertovat

Mitä laboratorion hyytymiskokeet kertovat Mitä laboratorion hyytymiskokeet kertovat Lotta Joutsi-Korhonen dos, kliinisen kemian erikoislääkäri Osastonylilääkäri HUSLAB Naantali 22.3.2013 Hemostaasijärjestelmä Hyytymisnäytteiden preanalytiikka

Lisätiedot

OPPIMISYMPÄRISTÖN LAATU VSSHP:SSÄ Osastonhoitajan näkökulma

OPPIMISYMPÄRISTÖN LAATU VSSHP:SSÄ Osastonhoitajan näkökulma OPPIMISYMPÄRISTÖN LAATU VSSHP:SSÄ Osastonhoitajan näkökulma Kati Kannisto Laboratoriohoitaja, SataDiag TtM- ja TtT-opiskelija Turun yliopisto Hoitotieteen laitos 29.04.2015 Esityksen sisältö 1. Tausta:

Lisätiedot

Glykoproteiinihormonien analytiikka. Henrik Alfthan HUSLAB Kliinisen kemian laitos

Glykoproteiinihormonien analytiikka. Henrik Alfthan HUSLAB Kliinisen kemian laitos Glykoproteiinihormonien analytiikka Henrik Alfthan HUSLAB Kliinisen kemian laitos Glykoproteiinihormonit Rakenne Molekyylimuodot Määritystekniikat Menetelmien kehitys Määritysongelmat Yazaki K et.

Lisätiedot

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian

Lisätiedot

Suopeuden ainekset. Dos. Ilpo Helén Biomedicine in Society (BitS) Department of Social Reseach

Suopeuden ainekset. Dos. Ilpo Helén Biomedicine in Society (BitS) Department of Social Reseach Biomedicine in Society (BitS) Department of Social Reseach Suopeuden ainekset 17.10.2013 1 Suomalaiset ovat suopeita biopankeille Pohjoismainen erityispiirre Mitä suopeus sisältää? Moninaiset yleisöt Laaja

Lisätiedot

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda

måndag 10 februari 14 Jaana Ohtonen Kielikoulu/Språkskolan Haparanda GENETIIKKA: KROMOSOMI DNA & GEENI Yksilön ominaisuudet 2 Yksilön ominaisuudet Perintötekijät 2 Yksilön ominaisuudet Perintötekijät Ympäristötekijät 2 Perittyjä ominaisuuksia 3 Leukakuoppa Perittyjä ominaisuuksia

Lisätiedot

SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO

SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO SISÄLLYSLUETTELO Sisällysluettelo Pääkirjoitus...3 Life Science Sigma-Aldrich kotisivun esittely...4 Molecular Cloning: A Laboratory Manual ja Merck Index

Lisätiedot

KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO

KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO KASVISSYÖJIEN KOLESTEROLI, VERENPAINE JA YLIPAINO Näyttöä väestötutkimuksista, 1960 2015 www.puolikiloa.fi 2 Meta- analyysi Tutkimus Maa Vuodet Key ym. 1999 Adven7st Mortality USA 1960 65 Mukana Adven7st

Lisätiedot

Oikea hoitopäätös minuuteissa

Oikea hoitopäätös minuuteissa 2 2013 QuikRead go Tuoteperhe täydentyy kahdella uudella testillä Nyt saatavana CRP+Hb yksi testi, kaksi tulosta Strep A laitelukuinen testi Oikea hoitopäätös minuuteissa Uudella Microsemi CRP -analysaattorilla

Lisätiedot

Istukkaverestä peräisin olevien mesenkymaalisten. kantasolujen komplementtiherkkyys. Pro gradu tutkielma

Istukkaverestä peräisin olevien mesenkymaalisten. kantasolujen komplementtiherkkyys. Pro gradu tutkielma Istukkaverestä peräisin olevien mesenkymaalisten kantasolujen komplementtiherkkyys Pro gradu tutkielma Minttu Mattila Jyväskylän yliopisto Bio- ja ympäristötieteiden laitos Solubiologia 19.2.2010 ALKUSANAT

Lisätiedot

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit

Peptidi ---- F ----- K ----- V ----- R ----- H ----- A ---- A. Siirtäjä-RNA:n (trna:n) (3 ) AAG UUC CAC GCA GUG CGU (5 ) antikodonit Helsingin yliopisto/tampereen yliopisto Henkilötunnus - Biokemian/bioteknologian valintakoe Sukunimi 24.5.2006 Etunimet Tehtävä 3 Pisteet / 20 Osa 1: Haluat selvittää -- F -- K -- V -- R -- H -- A peptidiä

Lisätiedot

18 (25) KUVA 17A. Hiivaa 400-kertaisella suurennoksella vaaleakentällä. KUVA 17B. Hiivaa 400-kertaisella suurennoksella faasikontrastilla.

18 (25) KUVA 17A. Hiivaa 400-kertaisella suurennoksella vaaleakentällä. KUVA 17B. Hiivaa 400-kertaisella suurennoksella faasikontrastilla. 18 (25) KUVA 17A. Hiivaa 400-kertaisella suurennoksella KUVA 17B. Hiivaa 400-kertaisella suurennoksella KUVA 18A. Hiivaa 400-kertaisella suurennoksella KUVA 18B. Hiivaa 400-kertaisella suurennoksella 4.4

Lisätiedot

Vedenlaadun seurannat murroksessa. Työkaluja laadukkaaseen mittaustulokseen

Vedenlaadun seurannat murroksessa. Työkaluja laadukkaaseen mittaustulokseen Vedenlaadun seurannat murroksessa Työkaluja laadukkaaseen mittaustulokseen FINAS-päivä 27.1.2015 Teemu Näykki FT, kemisti, tiiminvetäjä Taustaa Mittaustulos ei ole koskaan täysin oikein Lukuisia tärkeitä

Lisätiedot

47,XYY (Kun pojalla on ylimääräinen Y- kromosomi)

47,XYY (Kun pojalla on ylimääräinen Y- kromosomi) Tietolehtiset on tarkoitettu yleiskatsauksiksi johonkin tiettyyn oireyhtymään tai sairauteen, ne eivät korvaa perinnöllisyysneuvontaa tai erikoislääkärin konsultaatiota. 47,XYY (Kun pojalla on ylimääräinen

Lisätiedot

Mega Electronics Ltd 2011 2

Mega Electronics Ltd 2011 2 2013 Mega Electronics Ltd 2011 2 Mega Elektroniikka Oy Mega Elektroniikka Oy kehittää, valmistaa ja markkinoi ihmisen fysiologisiin mittauksiin soveltuvia mittalaitteita ja ohjelmistoja Yritys on toiminut

Lisätiedot

Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi

Lisätiedot

Tietojärjestelmäintegraatiot yksityisessä laboratoriossa. Maarit Orava, palvelujohtaja SKKY:n ja Sairaalakemistit ry:n syyskoulutuspäivät 15.11.

Tietojärjestelmäintegraatiot yksityisessä laboratoriossa. Maarit Orava, palvelujohtaja SKKY:n ja Sairaalakemistit ry:n syyskoulutuspäivät 15.11. Tietojärjestelmäintegraatiot yksityisessä laboratoriossa Maarit Orava, palvelujohtaja SKKY:n ja Sairaalakemistit ry:n syyskoulutuspäivät 15.11.2012 Sisältö Yhtyneet Medix Laboratoriot Oy Tuotantojärjestelmät

Lisätiedot

Marttisten sukuhaarojen Y- DNA tutkimus

Marttisten sukuhaarojen Y- DNA tutkimus Marttisten sukuhaarojen Y- DNA tutkimus Mikkeli 23.5. 2010 Pekka Haikkala Auvo Kostiainen Professori Auvo Kostiainen Filosofian tohtori, Yleisen historian professori Turun Yliopistossa Map of Delaware

Lisätiedot

Y-DNA ja sukututkimus

Y-DNA ja sukututkimus Y-DNA ja sukututkimus Tuomas Niilonpoika Mäntsän Jälkeläisten Sukujuhla Mänttä 1.9.2012 Sukututkimusta tukeva kirjallinen materiaali alkaa ilmaantua vasta 1500 luvulla (pl. papisto ja aateliset) Perinteinen

Lisätiedot

Päästä varpaisiin. Tehtävät. Ratkaisut. Päivitetty 8.4.2013 ISBN 978-951-37-6416-6, 978-951-37-6417-3, 978-951-6418-0. Sisällys (ratkaisut) Johdanto

Päästä varpaisiin. Tehtävät. Ratkaisut. Päivitetty 8.4.2013 ISBN 978-951-37-6416-6, 978-951-37-6417-3, 978-951-6418-0. Sisällys (ratkaisut) Johdanto OPETTAJAN AINEISTO Käyttöehdot Päästä varpaisiin Ihmisen anatomia ja fysiologia Eliisa Karhumäki Mari Kärkkäinen (os. Lehtonen) Päivitetty 8.4.2013 ISBN 978-951-37-6416-6, 978-951-37-6417-3, 978-951-6418-0

Lisätiedot

Natural Code Presentation 2011.01.07

Natural Code Presentation 2011.01.07 LUMENE LUMENE Excellent Future -ihonhoitosarja Natural Code Presentation 2011.01.07 Innovaatio- ja tuotekehitysjohtaja Tiina Isohanni, LUMENE OY Erikoistutkija Riitta Puupponen-Pimiä, VTT Huhtikuu 2012

Lisätiedot

SEMINAARI SFS:SSÄ UUDET YHTEISET STANDARDIT YMPÄRISTÖANALYTIIKKAAN? 13.5.2014 PENTTI MANNINEN

SEMINAARI SFS:SSÄ UUDET YHTEISET STANDARDIT YMPÄRISTÖANALYTIIKKAAN? 13.5.2014 PENTTI MANNINEN SEMINAARI SFS:SSÄ UUDET YHTEISET STANDARDIT YMPÄRISTÖANALYTIIKKAAN? 13.5.2014 PENTTI MANNINEN PROJECT HORIZONTAL (1) Euroopan komission rahoittama hanke, jonka puitteissa oli tarkoitus luoda yhtenäisiä

Lisätiedot

DBN Mitä sillä tekee? Dynaamisten Bayes-verkkojen määrittely aikasarja-analyysissä Janne Toivola jtoivola@iki.fi

DBN Mitä sillä tekee? Dynaamisten Bayes-verkkojen määrittely aikasarja-analyysissä Janne Toivola jtoivola@iki.fi DBN Mitä sillä tekee? Dynaamisten Bayes-verkkojen määrittely aikasarja-analyysissä Janne Toivola jtoivola@iki.fi Historiaa Bayesin kaavan hyödyntäminen BN-ohjelmistoja ollut ennenkin Tanskalaisten Hugin

Lisätiedot

Riista- ja kalatalouden tutkimuslaitos 12.12.2001 Marja-Liisa Koljonen. 1.1. Yleistä

Riista- ja kalatalouden tutkimuslaitos 12.12.2001 Marja-Liisa Koljonen. 1.1. Yleistä Geneettinen monimuotoisuus Suomen luonnonvaraisissa ja viljellyissä lohikannoissa ja tehollisten populaatiokokojen osuus todellisista emokalamääristä DNA:n mikrosatelliittimuuntelun avulla arvioituna Riista-

Lisätiedot

VARAUS JA LIIKERAJOITUKSET LONKAN TEKONIVELLEIKKAUKSEN JÄLKEEN

VARAUS JA LIIKERAJOITUKSET LONKAN TEKONIVELLEIKKAUKSEN JÄLKEEN JARI SYRJÄNEN, ORTOPEDI ORTON OY, TEKONIVELOSASTO VARAUS JA LIIKERAJOITUKSET LONKAN TEKONIVELLEIKKAUKSEN JÄLKEEN Sidonnaisuudet Smith & Nephew Zimmer Stryker Biomet DePuy Historiaa Perinteenä ollut rajoiuaa

Lisätiedot

Naudan geenikartoitus

Naudan geenikartoitus KOTIELÄINJALOSTUKSEN TIEDOTE No 87 Naudan geenikartoitus Kalle Maijala Helsingin Yliopisto, Biotekniilcan instituutti ja Kotieläinten jalostustieteen laitos Helsinki 1989 Julkaisijat: Kotieläinten jalostustieteen

Lisätiedot

Evidence-Based Medicine and Health Problems in People with Intellectual Disabilities. Maria Arvio, MD, PhD

Evidence-Based Medicine and Health Problems in People with Intellectual Disabilities. Maria Arvio, MD, PhD Evidence-Based Medicine and Health Problems in People with Intellectual Disabilities Maria Arvio, MD, PhD What is intellectual disability (ID) medicine? The health problems of patients with ID represent

Lisätiedot