mtorc1 and CK2 coordinate ternary and eif4f complex assembly
|
|
- Hanna-Mari Toivonen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 mtorc1 and CK2 coordinate ternary and eif4f complex assembly Valentina Gandin 1,2,3,4 *, Laia Masvidal 5 *, Marie Cargnello 1,2,3,4 *, Laszlo Gyenis 6, Shannon McLaughlan 1,2,3,4, Yutian Cai 1,2,3,4, Clara Tenkerian 1,6, Masahiro Morita 3, Preetika Balanathan 7, Olivier Jean-Jean 8, Vuk Stambolic 9, Matthias Trost 10, Luc Furic 7, Louise Larose 11, Antonis E. Koromilas 1,4,6, Katsura Asano 12, David Litchfield 6, Ola Larsson 5 ** and Ivan Topisirovic 1,2,3,4 ** Supplementary material containing Supplementary figures 1-10.
2 Supplementary Fig. 1 CK2 inhibition impairs the eif4f complex assembly, and reduces eif2β phosphorylation, whereas loss of upstream negative regulators of mtor attenuates the effects of CK2 inhibitors on eif2β phosphorylation (a-b) MCF7 (a) or HCT116 (b) cells were treated with indicated concentrations of CX-4945 and torin1 for 30 minutes, after which cells were lysed and lysates were subjected to a m 7 GTP cap-pull down assay. Levels and phosphorylation status of indicated proteins in the pulled down material and inputs (10%) were determined by Western blotting. β-actin served as a loading control for the inputs and to exclude possible contamination of m 7 GTP cap-pull downs. (c) HCT116 PTEN +/+ and PTEN -/- maintained in 10% serum (FBS) were treated with a vehicle (DMSO) or 50μM CX-4945 for 7 hours. (d-f) TSC2 +/+ and TSC2 -/- mouse embryonic fibroblasts (MEFs) were starved for 24 hours in 0.1% serum (FBS) and stimulated with 10% FBS in the presence of a vehicle (DMSO), 250 nm torin1 (d), or 50μM CX-4945 (e) for 2 hours. In addition, cells were maintained in 10% or 0.1% serum (FBS) for 24 hours without treatments (f). Phosphorylation status and expression of indicated proteins were monitored by Western blotting. β-actin served as a loading control for the inputs. Experiments are representative of at least 2 independent experiments. Quantification was performed using densitometry (Suppl. Fig 9).
3 Supplementary Fig 2 (legend below)
4 Supplementary Fig. 2 mtorc1 phosphorylates eif2β on serines 2 and 67 (a) Putative TOS motifs of eif2β and known mtorc1 substrates and their position in the proteins are indicated in the table. (b) Alignment of eif2β regions containing S2 and S67 phospho-acceptor sites [(S2-p) and (S67-p); shown in red] and TOS motif in indicated species. (c-e) In vitro mtorc1 kinase assay (left panel) was carried out using recombinant wild type (WT) or indicated eif2β mutants. mtorc1 was isolated by HA-immunoprecipitation from HEK293E cells transfected with HA-Raptor (see methods) that were serum starved for 16h and then stimulated with 10% serum in the presence of a vehicle (DMSO) or torin1 (250 nm) for 30 minutes. Coomassie staining indicates the quantity of eif2β variants used in mtorc1 kinase assay. (f) Far-UV circular dichroism (CD) spectra of indicated recombinant eif2β proteins. Θ (ellipticity in millidegrees); λ (wavelength in nanometers). (g) U20S cells overexpressing HA-CK2a and myc-ck2b were serum starved for 16h and stimulated with serum (10%) for 30 min followed by immunoprecipitation with an anti-raptor antibody. (h) HEK293E cells were grown in the absence (-FBS 12h ) or presence (+FBS 12h ) of 10% fetal bovine serum (FBS) for 12h. In addition, serum starved cells were stimulated with 10% FBS for 30 minutes (-FBS 12h +FBS 30min ). Lysates were immunoprecipitated using an anti-raptor antibody. Isotype matched anti-ha antibody served as a negative control. Immunoprecipitated material (25%) and inputs (10%) were analyzed by Western blotting using indicated antibodies. β-actin served as a loading control for the inputs and to exclude possible contamination due to non-specific interactions in the immunoprecipitation reactions, whereas S6K1/2 phosphorylation in the inputs was used to determine mtor activity. H.C.- heavy chains. (i) HEK293E cells were transfected with the indicated constructs, serum starved for 16h and stimulated with 10% serum (FBS) for 30min before FLAG-immunoprecipitation. Immunoprecipitated material (25%) and inputs (10%) were analyzed by Western blotting using the indicated antibodies. To capture native mtor complexes, immunoprecipitations in (h, i) were carried out in the presence of the cross-linker 3,3 -dithiobis (sulfosuccinimidylpropionate) DTTSP (see methods). (j) HEK293E cells expressing indicated eif2β constructs were immunoprecipitated with an anti-ck2α antibody and the levels of indicated proteins in inputs (10%) and immunoprecipitates (25%) were determined by Western blotting. Experiments in this panel were repeated at least 2 times independently, and representative data are shown.
5 Supplementary Fig. 3. (legend below)
6 Suppl. Fig. 3. eif2β phosphorylation stimulates mrna translation. (a-c) Translation of m 7 GpppG-Renilla luciferasepoly(a) mrna (50 ng) was monitored in RRL supplemented with increasing amounts of eif2β WT, S(2,67)A or TOS mutant (a) or in RRLs in which eif2 was immunodepleted using an anti-eif2β antibody and rescued with recombinant eif2α/γ and equimolar amounts of recombinant eif2β WT, S(2,67)A or TOS mutant (b-c). Translation of m 7 GpppG-Renilla luciferase-poly(a) mrna was monitored by luciferase assay (a, c). Experiments were performed in independent triplicate and data are presented as log2 transformed and normalized (per replicate and the mean of the control) means and SDs. P- values from a 1-way ANOVA for an amount effect (for WT, S(2,67)A or TOS mutant separately) and from 2-way ANOVAs comparing treatments are indicated. Levels of endogenous and recombinant proteins were monitored by Western blotting using indicated antibodies. rps6 (a) and eif4e (b) were used as loading control. Coomassie staining was used to determine the levels and purity of recombinant eif2β proteins (b). (d) Phosphorylation status and levels of indicated recombinant eif2β variants in rabbit reticulocyte lysates (RRL) were monitored by Western blotting. (e) HEK293E cells expressing indicated eif2β constructs were serum starved for 16h, and then serum stimulated for 4h after which cells were lysed and cytosolic extracts were sedimented on 15-35% sucrose by ultracentrifugation. Position of 40S and 60S ribosomal subunits as well as 80S monosome are denoted in the absorbance profiles (254nm). 80S ratios between cells expressing indicated eif2β constructs and control cells were calculated by dividing areas under corresponding 80S peaks.
7 Supplementary Fig. 4. (legend below)
8 Supplementary Fig. 4. eif2β depletion has deleterious effects on HEK293E cells, while eif2β phosphorylation Met increases eif2:trna i association (a) HEK293E cells were depleted of eif2β or infected with scrambled control shrna. Phase/contrast images show that upon 48h of eif2β depletion the vast majority of the cells were dead. (b) To overcome cell toxicity caused by eif2β depletion, HEK293E cells were first infected with empty vector or indicated eif2β constructs and 72 hours later with scrambled control (Scr) or eif2β shrna (shrnaeif2β), respectively. In this way cells in lanes 3-6 express indicated exogenous FLAG-tagged eif2β variants and are depleted of endogenous eif2β, whereas control cells (infected with vector+scrambled shrna) express endogenous eif2β. Levels of indicated proteins were determined by Western blotting. β-actin served as a loading control. (c) Levels and the phosphorylation status of indicated proteins in cells described in (b) were monitored by Western blotting. Total eif2α levels served as a loading control. Experiments were carried out 3 times independently and representative data are shown. Were appropriate densitometry was performed (Suppl. Fig. 9). (b-c) Endogenous (endog.) and exogenous (exog.) variants of eif2β proteins detected by an anti-eif2β or antiphopsho Ser2 eif2β antibody are shown (d) Cells described in (b) were serum starved for 16h, stimulated with serum (10%) for 30 min and subjected to FLAG-immunoprecipitation as in Fig 4a. (e) Cells expressing WT or S(2,67)D eif2β mutant were serum starved for 16h and then stimulated with 10% serum (FBS) in the presence of a vehicle (DMSO), rapamycin (50 nm) or torin1 (250 nm) for 30 min as in Fig. 4b. Lysates were immunoprecipitated with an anti-flag antibody. (d-e) The Met amount of trna i in the immunoprecipitated material was monitored by quantitative reverse-transcription PCR (qrt- PCR). trna Lys was used as a negative control. Experiments were carried out in independent duplicate consisting of 3 technical replicates each. Means from technical replicates were log2 transformed, normalized per replicate and to the mean of the control, and are shown as mean and standard deviations. P-values from 1-way ANOVAs are indicated.
9 Supplementary Fig. 5 PERK and PKR do not appear to act as major mediators of the effects of eif2β on eif2α phosphorylation, whereas the effects of CK2 inhibition on eif2β phosphorylation and eif2β:nck1 association are attenuated in the cells lacking PTEN. (a) Expression and phosphorylation status of indicated proteins in HEK293E cells expressing eif2β constructs that were depleted of endogenous eif2β by shrna (sheif2β) and HEK293E cells infected with empty vector and scrambled (Scr) shrna (control) (Supplementary Fig. 4b) were monitored by Western blotting using indicated antibodies. β-actin served as a loading control. (b) HEK293E cells expressing WT and S(2,67)D eif2β mutant in which endogenous eif2β was depleted by shrna were treated with increasing concentrations of thapsigargin for 4 hours and the expression and phosphorylation status of indicated proteins were determined by Western blotting. (c) HCT116 PTEN +/+ and PTEN -/- cells transfected with an empty vector/scrambled (Scr) shrna (control) or eif2β shrna and shrnainsensitive FLAG-WT eif2β were immunoprecipitated with an anti-flag antibody and the amount of indicated proteins in the inputs (10%) and immunoprecipitates (25%) were determined by Western blotting. (d) Cells described in (c) were treated with torin1 (250nM) or CX-4945 (50μM) for the indicated time periods, after which anti-flag antibody immunoprecipitations were carried out. (c-d) β-actin served as a loading control in the inputs. Levels and the phosphorylation status of indicated proteins in the inputs (10%) and immunoprecipitates were determined by Western blotting. Endogenous (endog.) and exogenous (exog.) variants of eif2β proteins detected by an anti-eif2β or anti-phospho Ser2 eif2β antibody are indicated. Experiments were repeated twice independently and representative results are shown.
10 Supplementary Fig. 6. eif2β phosphorylation promotes cell proliferation under conditions when mtor signaling is inhibited. (a) HEK293E cells expressing eif2β constructs in which endogenous eif2β was depleted by shrna (Supplementary Fig 4b) were maintained in 10% or 0.5% serum (FBS) for indicated time and proliferation was monitored by BrdU incorporation. Results are presented as mean absorbance at 370nm +/- SD from 3 independent experiments (b) Cells described in (a) were maintained in absence of amino acids for indicated time points and proliferation was measured as in (a). (c) Effects of amino acid deprivation on the expression and phosphorylation status of indicated proteins were determined by Western blotting. Total rps6 was used as loading control. Experiments were repeated 2 times independently, and representative results are shown.
11 Supplementary Fig. 7. eif2β phosphorylation mediates the effects of mtorc1 and CK2 on cell proliferation. (a) HEK293E cells expressing the indicated eif2β variants in which endogenous eif2β was depleted by shrna (Supplementary Fig. 4b) were treated with a vehicle (DMSO) or CX-4945 (10mM) for indicated times. (b) Cells described in (a) were incubated with a vehicle (DMSO) or salubrinal (1μM) for indicated times. (a-b) Proliferation was measured by BrdU incorporation, and the results are presented as mean absorbance +/- SD from triplicate experiments. (c) Expression and the phosphorylation status of indicated proteins were measured by Western blotting. β-actin served as a loading control. Representative blots of 2 independent experiments are shown.
12 Suppl. Fig. 8. eif2α phosphorylation mediates the effects of eif2β phosphorylation on cell proliferation (a) HT1080 WT or HT1080 eif2α S51A mutant (KI) cells expressing the indicated eif2β constructs were maintained in 10% serum and proliferation was measured at indicated time points by BrdU incorporation. Results are represented as mean absorbance +/- SD from independent triplicate experiments. (b-c) Expression levels and phosphorylation status of indicated proteins in HT1080 WT or HT1080 KI cells were monitored by Western blotting. As a control, cells were treated with DTT (2mM) for 1h to induce eif2α phosphorylation. Representative blots of 2 independent experiments are presented.
13 Supplementary Fig. 9. (continued below; legend on page 15)
14
15
16 Supplementary Fig. 10 (continued below; legend on page 32)
17 Supplementary Fig. 10 (continued below; legend on page 32)
18 Supplementary Fig. 10 (continued below; legend on page 32)
19 Supplementary Fig. 10 (continued below; legend on page 32)
20
21 Supplementary Fig. 10 (continued below; legend on page 32) Supplementary Fig. 10 (continued below; legend on page 32)
22 Supplementary Fig. 10 (continued below; legend on page 32)
23
24 Supplementary Fig. 10 (continued below; legend on page 32) Supplementary Fig. 10 (continued below; legend on page 32)
25 Supplementary Fig. 10 (continued below; legend on page 32)
26 Supplementary Fig. 10 (continued below; legend on page 32)
27 Supplementary Fig. 10 (continued below; legend on page 32)
28 Supplementary Fig. 10 (continued below; legend on page 32)
29 Supplementary Fig. 10 (continued below; legend on page 32)
30 Supplementary Fig. 10 (continued below; legend on page 32)
31 Supplementary Fig. 10 (continued below; legend on page 32)
32 Supplementary Fig. 10 Scans of the uncropped films and images of agarose gels that were used in the manuscript. Boxes indicate approximate portions of the films that are included in the figures. Films were re-scanned to obtain larger area around the bands, therefore causing slight differences in the contrast. Below the scans it is indicated to which figure they correspond.
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
Plasmid construction PCR reactions were carried out with Pfu or Pfu turbo polymerases (Stratagene) unless otherwise stated.
Expanding the Genetic Code of Yeast for Incorporation of Diverse Unnatural Amino Acids via a Pyrrolysyl-tRNA Synthetase/tRNA Pair Susan M. Hancock 1, Rajendra Uprety 2, Alexander Deiters 2 & Jason W. Chin
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Supplementary Table S1. Material list (a) Parameters Sal to Str
Tooth wear as a means to quantify intra-specific variations in diet and chewing movements - Scientific Reports 2016, 6:3037 Ivan Calandra, Gaëlle Labonne, Ellen Schulz-Kornas, Thomas M. Kaiser & Sophie
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Strain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC
TABLE S1 Bacterial strains and plasmids Strain or plasmid Description a Reference or source b B. subtilis 168 trpc2 Laboratory stock 1A780 trpc2 sigb::spc BGSC BM1010 trpc2 htpx::pgs1582; Em r BM1302 trpc2
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269
TM ETRS-TM35FIN-ETRS89 WTG
VE1 SHADOW - Main Result Calculation: 8 x Nordex N131 x HH145m Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
Metsälamminkankaan tuulivoimapuiston osayleiskaava
VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations
WindPRO version joulu 2012 Printed/Page :47 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145
OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 5.11.2013 16:44 / 1 Minimum
Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a
, Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Supporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
,0 Yes ,0 120, ,8
SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
( ,5 1 1,5 2 km
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 4 5 3 1 2 6 7 8 9 10 0 0,5 1 1,5 2 km
S Sähkön jakelu ja markkinat S Electricity Distribution and Markets
S-18.3153 Sähkön jakelu ja markkinat S-18.3154 Electricity Distribution and Markets Voltage Sag 1) Kolmivaiheinen vastukseton oikosulku tapahtuu 20 kv lähdöllä etäisyydellä 1 km, 3 km, 5 km, 8 km, 10 km
Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 22.12.2014 11:33 / 1 Minimum
TEST REPORT Nro VTT-S Air tightness and strength tests for Furanflex exhaust air ducts
TEST REPORT Nro VTT-S-04515-08 19.5.008 Air tightness and strength tests for Furanflex exhaust air ducts Requested by: Hormex Oy TEST REPORT NRO VTT-S-04515-08 1 () Requested by Order Hormex Oy Linnanherrankuja
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
Rakennukset Varjostus "real case" h/a 0,5 1,5
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 1 2 3 5 8 4 6 7 9 10 0 0,5 1 1,5 2 km
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
class I T (Munz, autophagy (Argiris, 2008) 30 5 (Jemal, 2009) autophagy HLA / 4 21 (Sakakura, 2007; Chikamatsu, 2008; Chikamatsu, 2009) in vitro
65 35 (Argiris, 2008)30 5 (Jemal, 2009) / 1991Boon / 4 21 (Sakakura, 2007; Chikamatsu, 2008; Chikamatsu, 2009) / / (Sakakura, 2005; Sakakura, 2006; Sakakura, 2007; Chikamatsu, 2007; Chikamatsu, 2008)/
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
Digital Admap Native. Campaign: Kesko supermarket
Digital Admap Native Campaign: Kesko supermarket Digital Admap Native Campaign: Kesko Supermarket Mainosmuoto: Natiivi Media: IS.fi Campaign period: 25 September Date of measurement: 26 September Unique:
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa?
Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Kerro meille datastasi työpaja 10.4.2013 Antti Auer Tietohallintopäällikkö Jyväskylän yliopisto Strateginen kehittäminen Johtamista, tutkimushallintoa
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
OMINAISUUDET SOVELLUS. Technical data sheet BOAX-II HDG - KIILA-ANKKURI. Mutterin ja aluslevyn kanssa. UK-DoP-e08/0276, ETA-08/0276.
BOAX-II - KIILA-ANKKURI Mutterin ja aluslevyn kanssa. UK-DoP-e08/0276, ETA-08/0276 OMINAISUUDET Materiaali Kuumasinkitty teräs SOVELLUS Käyttötarkoitus Teräsrakenteiden Kiskojen Kannattimien Julkisivujen
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
Online Supplement 1 Foudi et al. 2008
Online Supplement 1 Foudi et al. 2008 This supplementary file contains: I) Supplementary Figures 1-10 II) Supplementary References (38-42) M2-rtT ROS26 S M2-rtT -globin poly + doxycycline S+poly TetOP
Digitally signed by Hans Vadbäck DN: cn=hans Vadbäck, o, ou=fcg Suunnittelu ja Tekniikka Oy, email=hans.vadback@fcg.fi, c=fi Date: 2016.12.20 15:45:35 +02'00' Jakob Kjellman Digitally signed by Jakob Kjellman
Curriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
SELL Student Games kansainvälinen opiskelijaurheilutapahtuma
SELL Student Games kansainvälinen opiskelijaurheilutapahtuma Painonnosto 13.5.2016 (kansallinen, CUP) Below in English Paikka: Nääshalli Näsijärvenkatu 8 33210 Tampere Alustava aikataulu: Punnitus 12:00-13:00
FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
LUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10)
RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
21~--~--~r--1~~--~--~~r--1~
- K.Loberg FYSE420 DIGITAL ELECTRONICS 13.05.2011 1. Toteuta alla esitetyn sekvenssin tuottava asynkroninen pun. Anna heratefunktiot, siirtotaulukko ja kokonaistilataulukko ( exitation functions, transition
S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA
S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen
Underpinning Phage Arbitrium Communication Systems
Molecular Cell, Volume 74 Supplemental Information Deciphering the Molecular Mechanism Underpinning Phage Arbitrium Communication Systems Francisca Gallego del Sol, José R. Penadés, and Alberto Marina
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Tree map system in harvester
Tree map system in harvester Fibic seminar 12.6.2013 Lahti Timo Melkas, Metsäteho Oy Mikko Miettinen, Argone Oy Kalle Einola, Ponsse Oyj Project goals EffFibre project 2011-2013 (WP3) To evaluate the accuracy
DS-tunnusten haku Outi Jäppinen CIMO
DS-tunnusten haku 2013 Outi Jäppinen CIMO 2/2009 DS-tunnukset ECTS- ja DS-tunnusten avulla pyritään edistämään ECTS-järjestelmän sekä tutkintotodistuksen liitteen Diploma Supplementin asianmukaista käyttöä
DATA ENVELOPMENT ANALYSIS
Mat-2.4142 Seminar n Optimizatin DATA ENVELOPMENT ANALYSIS Scale Elasticity and Cngestin 14.11.2007 Cntents Intrductin Scale Elasticity in Prductin Cngestin Strng Cngestin Hme Assignment Cntents Intrductin
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
( N117 x HH141 ( Honkajoki N117 x 9 x HH120 tv-alueet ( ( ( ( ( ( ( ( ( ( m. Honkajoki & Kankaanpää tuulivoimahankkeet
Honkajoki & Kankaanpää tuulivoimahankkeet N117 x HH141 Honkajoki N117 x 9 x HH120 tv-alueet Alahonkajoki_kaava_alueen_raja_polyline Asuinrakennus Julkinen tai liiker rak. Lomarakennus Teollinen rak. Allas
Rotarypiiri 1420 Piiriapurahoista myönnettävät stipendit
Rotarypiiri 1420 Piiriapurahoista myönnettävät stipendit Ø Rotarypiiri myöntää stipendejä sille osoitettujen hakemusten perusteella ensisijaisesti rotaryaatteen mukaisiin tarkoituksiin. Ø Stipendejä myönnetään
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
Travel General. General - Essentials. General - Conversation. Asking for help. Asking if a person speaks English
- Essentials Voisitko auttaa minua? Asking for help Puhutko englantia? Asking if a person speaks English Puhutteko _[kieltä]_? Asking if a person speaks a certain language En puhu _[kieltä]_. Clarifying
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Title: Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae
Title: Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae Authors: Yoichiro Ito, Takao Kitagawa, Mamoru Yamanishi, Satoshi Katahira,
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
x = y x i = y i i = 1, 2; x + y = (x 1 + y 1, x 2 + y 2 ); x y = (x 1 y 1, x 2 + y 2 );
LINEAARIALGEBRA Harjoituksia/Exercises 2017 1. Olkoon n Z +. Osoita, että (R n, +, ) on lineaariavaruus, kun vektoreiden x = (x 1,..., x n ), y = (y 1,..., y n ) identtisyys, yhteenlasku ja reaaliluvulla
MIKES, Julkaisu J3/2000 MASS COMPARISON M3. Comparison of 1 kg and 10 kg weights between MIKES and three FINAS accredited calibration laboratories
MITTATEKNIIKAN KESKUS CENTRE FOR METROLOGY AND ACCREDITATION Julkaisu J3/2000 MASS COMPARISON M3 Comparison of 1 kg and 10 kg weights between MIKES and three FINAS accredited calibration laboratories Kari
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
Small Number Counts to 100. Story transcript: English and Blackfoot
Small Number Counts to 100. Story transcript: English and Blackfoot Small Number is a 5 year-old boy who gets into a lot of mischief. He lives with his Grandma and Grandpa, who patiently put up with his
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
Business Opening. Arvoisa Herra Presidentti Very formal, recipient has a special title that must be used in place of their name
- Opening Finnish Norwegian Arvoisa Herra Presidentti Very formal, recipient has a special title that must be used in place of their name Hyvä Herra, Formal, male recipient, name unknown Hyvä Rouva Formal,
OFFICE 365 OPISKELIJOILLE
OFFICE 365 OPISKELIJOILLE Table of Contents Articles... 3 Ohjeet Office 365 käyttöönottoon... 4 One Driveen tallennetun videon palauttaminen oppimisympäristön palautuskansioon... 5 Changing default language
DIGITAL MARKETING LANDSCAPE. Maatalous-metsätieteellinen tiedekunta
DIGITAL MARKETING LANDSCAPE Mobile marketing, services and games MOBILE TECHNOLOGIES Handset technologies Network technologies Application technologies INTRODUCTION TO MOBILE TECHNOLOGIES COMPANY PERSPECTIVE
SIMULINK S-funktiot. SIMULINK S-funktiot
S-funktio on ohjelmointikielellä (Matlab, C, Fortran) laadittu oma algoritmi tai dynaamisen järjestelmän kuvaus, jota voidaan käyttää Simulink-malleissa kuin mitä tahansa valmista lohkoa. S-funktion rakenne
* lotta.laine@cancer.fi for more information. Sakari Nurmela
Finnish families and holidays in the Sun Views among parents of underaged children about sunprotection on holiday trips Lotta Laine*, Liisa Pylkkänen, and Tapani Koskela Cancer Society of Finland Finnish
Capacity utilization
Mat-2.4142 Seminar on optimization Capacity utilization 12.12.2007 Contents Summary of chapter 14 Related DEA-solver models Illustrative examples Measure of technical capacity utilization Price-based measure
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Telecommunication Software
Telecommunication Software Final exam 21.11.2006 COMPUTER ENGINEERING LABORATORY 521265A Vastaukset englanniksi tai suomeksi. / Answers in English or in Finnish. 1. (a) Määrittele sovellusviesti, PersonnelRecord,
30.4.2013 OMINAISUUDET
Tekniset tiedot Sivu 1 / 5 OMINAISUUDET on uusi, kevyt umpisoluinen polyeteenivaahtomuovi, jonka solurakenne avataan erillisessä valmistusprosessissa. Näin saadaan aikaan erittäin tehokas absorptiomateriaali,
KMTK lentoestetyöpaja - Osa 2
KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...
ELEMET- MOCASTRO. Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions. Period
1 ELEMET- MOCASTRO Effect of grain size on A 3 temperatures in C-Mn and low alloyed steels - Gleeble tests and predictions Period 20.02-25.05.2012 Diaarinumero Rahoituspäätöksen numero 1114/31/2010 502/10
Pancreatic Islet Cell Death
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 360 MEKK-1 and NF-κB Signaling in Pancreatic Islet Cell Death DARIUSH MOKHTARI ACTA UNIVERSITATIS UPSALIENSIS UPPSALA
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis