Online Supplement 1 Foudi et al. 2008
|
|
- Lasse Härkönen
- 6 vuotta sitten
- Katselukertoja:
Transkriptio
1 Online Supplement 1 Foudi et al This supplementary file contains: I) Supplementary Figures 1-10 II) Supplementary References (38-42)
2 M2-rtT ROS26 S M2-rtT -globin poly + doxycycline S+poly TetOP H2-GFP -globin poly teto-h2-gfp wild type C -DOX +DOX ROS26 locus Col11 locus 6.2kb 4kb GFP D brightfield Supplementary Figure 1: Generation of ES cells and mice that permit inducible expression of H2-GFP. () lleles used to generate EScells and mice with doxycycline-inducible expression of H2-GFP. (Top) The M2 reverse tetracycline transactivator (M2-rtT) is driven by the constitutive ROS26 promoter (R26::rtT) 31,32. (ottom) previously characterized H2-GFP cdn 8 was inserted downstream of the Collagen (Col) 11 locus under the control of a tetracycline-dependent minimal CMV promoter by recombinase-mediated site-specific integration as previously described 31. S, splice acceptor; TetOP, tetracycline operator elements fused to CMV minimal promoter. () Southern blot analysis confirming integration of the H2-GFP transgene downstream of Col11 locus. (C) ES-cells containing both the R26::rtT and the TetOP-H2-GFP allele turn green in the presence of the tetracycline analog doxycycline. These ES cells were used to produce chimeric animals and germline offspring (data not shown). (D) Experimental scheme: mice harboring M2-rtT and H2-GFP were subjected to doxycycline in their drinking water for 6 weeks to achieve widespread acquisition of green fluorescence. Subsequently, mice were checked for the retention of H2-GFP in the absence of doxycycline at defined intervals for up to 72 weeks after the end of doxycycline administration.
3 % Donor (CD45.2) % Donor (CD45.2) 0 L - K + S n=2 L - K + S + L - K + S n=4 n= * weeks % Donor (CD45.2) % Donor (CD45.2) L - K + S n=5 weeks Granulocytes (Gr1 + /Mac1 + ) -cells (220+) weeks weeks Supplementary Figure 2: expression distinguishes long-term from short-term repopulating HSCs. nalysis of CD45-isotype expression in peripheral blood lymphocytes and granulocytes after transplantation of highly purified early bone marrow populations (donor, CD45.2) into irradiated hosts (CD45.1) together with a small number of support marrow cells (CD45.1) to ensure survival. The four plots show the proportions of donorderived -cells and granulocytes in groups of mice that had received 50 cells from sub-fractions of the Lineage - (L), c- Kit + (K), Sca1 + (S)-population further resolved by SLM markers (48) and (150) as indicated by the letter/number code in each panel (flow-cytometry of these populations is shown in Figure 1, first panel on the right). Note: -positive L - K + S + -cells did not give rise to donor-contribution (upper panels). Within the -negative fractions (lower panels), -negative cells (left) gave rise to transient hematopoiesis and -positive cells (right) gave rise to long-term engraftment. *Persistent blood lymphoid cells in lower left panel represent re-circulating -cells as early bone marrow -cells are not donor-derived in these mice (see Supplementary Figure S3 for bone marrow contribution analysis of selected mice from lower panels). Individual data points represent means from analysis of groups of mice, number of mice (n) given in each panel, error bars represent standard deviation in upper left panel and standard error of mean in all other panels.
4 Supplementary Figure 3: Host and donor contributions to bone marrow hematopoiesis after transplantation of -positive and -negative - L - K + S + cells. one marrow analysis of selected mice from lower panels in Supplementary Fig. 2. Shown are donor (CD45.2) or host (CD45.1) contributions to bone marrow hematopoiesis after transplantation of -negative (left panels) or -positive (right panels) donor cells 26 weeks after transplantation. () Contribution to -cells and myeloid cells. () Contribution to stem cells (LKS). Note: myeloid cells (Gr1 + / Mac1 + ; upper panel), early -cells (220 + /IgM -, middle panel), and L - S + K + -cells are derived from the donor only after transplantation of + cells.
5 C D E F CD EPCR Endoglin H2-GFP H2-GFP H2-GFP H2-GFP Flt3 H2-GFP H2-GFP G H I J L LKS CD LKS EPCR hi LKS Flt3 - LKS Flt LKS Endoglin hi LKS Flt K Supplementary Figure 4: H2- GFP retention correlates with multiple alternative markers for long-term repopulating HSCs, but not with expression of MNCD-2. (-E) Left column shows HSCs (L - K + S + ) stained with SLM markers / 4, CD34 14, Endothelial Protein C Receptor (EPCR) 17, Endoglin 18, and Flt3 19, all of which predict long-term repopulation potential. (F) Left plot shows HSCs (L - K + S + Flt3 - ) stained with MNCD-2, an antibody that has been claimed to recognize N-cadherin 20 by flow-cytometry (see Supplementary Figure 7). Dotted lines in -F indicate arbitrary threshold set to result in less than 5% events above threshold with isotype-matched control antibody. Right plots show H2-GFP content of the total population (gray shaded area, L - K + S + in -E, L - K + S + Flt3 - in F) or gated populations as indicated (red arrows and red curves). Shown is one representative out of three similar experiments performed after 16 weeks of chase (see Supplementary Fig. 1D). (G-L) SLM-marker profiles of HSCs identified by alternative markers (-F). Previous gating strategies are indicated on plots in red (as shown in -F). (G) The majority of CD34-negative HSCs are - +. (H) EPCR hi HSCs are predominantly -negative. (I) Endoglin hi HSCs are predominantly - +. (J, K) Flt3 - HSCs contain the majority of the - + cells. (L) MNCD-2 + HSCs are not biased toward a particular SLM-marker profile.
6 LKS Flt H2-GFP LKS Flt IgG2a H2-GFP Supplementary Figure 5: H2-GFP retention of MNCD-2 or isotype control stained HSCs using alternative gating strategy. () H2-GFP retention of MNCD-2 stained HSCs as shown in Supplementary Figure 4F, but with alternative gates. While we could not discern distinct expression levels of MNCD-2 as reported 20 because of the low intensity of the stain, these gates represent our best approximation of low (blue frame) and intermediate (red frame) expression levels. Note that there is a small difference in H2-GFP retention but the same is seen with the isotype control ().
7 c-kit Lin - Flt3 - PI - gated LKS + Flt3 - LKS - LKS + gated LKS C Sca IgG2a Lin + PI Lin + PI D 220 Scatter PI- gated IgM - Pre and Pro low IgM + Immature hi IgM + Mature IgM Supplementary Figure 6: Characterization of MNCD-2 staining in the adult bone marrow. (, ) Dim staining with MNCD-2 is detectable on HSCs (Flt3 - L - K + S + (), + - L - K + S + (), red curves) and myeloid progenitors ((), blue curve) compared to isotype control (gray shaded areas). (C) right staining with MNCD-2 (left panel) but not isotype control (right panel) on lineage positive cells. (D) Progressive up-regulation of MNCD-2 during -cell maturation in the bone marrow. Note that this staining profile does not represent N-cadherin expression (shown in Supplementary Figure 7).
8 Isotype 4.3 Flt3 - L - K + S + Control 17.4 Isotype 4.7 Flt3 - L - K + S + Ncad KO 220 hi IgM + Control 18.7 Isotype Isotype hi IgM + Ncad KO 96.5 C Lin + LKS + Control KO Control KO floxed wt deleted Supplementary Figure 7: nalysis of MNCD-2 binding in the adult bone marrow cells two months after pipc mediated disruption of a conditional N-cadherin allele using Mx-Cre reveals that MNCD-2 staining is independent of N-cadherin expression. (, ) MNCD-2 staining of HSCs (Flt3 - L - K + S + ) () and mature -cells () in pipctreated control (left panels) and conditional N-cadherin knockout bone marrow supplementary ref. 38 (right panels). Note that the MNCD-2 stain was not affected by disruption of N-cadherin. (C) Conditional N-cadherin was excised in sorted HSCs (LKS + ) and sorted lineage marker + cells from conditional knockout mice (Genotype: Mx-Cre, N-cadherin floxed/floxed) but not pipc treated controls (Genotype: No Cre, N- cadherin floxed/ wildtype) (primers as described supplementary ref. 38 ). Note: These data demonstrate that MNCD-2 does not recognize N- cadherin on hematopoietic cells when used in flow-cytometry. Thus the ligand for MNCD-2 in hematopoiesis is dubious, even if previous studies have shown that MNCD-2 binds to N-cadherin in Western blot analysis of neuronal tissue supplementary ref. 39,40.
9 n=21 n=42 Supplementary Figure 8: H2-GFP of label-retaining HSCs is distributed equally to daughter cells at the time of division. Highly purified HSCs ( + - L - K + S + ) from H2- GFP mice, 20 weeks after the pulse, were single-cell sorted into individual culture wells containing stem cell factor, thrombopoetin, and interleukin-3 to induce division supplementary ref. 41,42. () Fluorescence was quantified before and after the first division. Pixel intensity of individual cells is shown in white numbers, pixel intensity of all cell is shown in yellow. () ar graphs show mean fluorescence of daughter cells (right bar) as the percentage of the fluorescence of the parental cells (left bar, set at 1); number of cells analyzed and standard deviations are given below.
10 Gate I L - K + S H2-GFP neg 28 ± Gate II H2-GFP int 48 ± Gate III H2-GFP hi 83 ± 9 29 I 39.3 II 23.2 III CD34 H2-GFP CD34 CD34 C Gate I H2-GFP neg 7 ± 2 Gate II H2-GFP int 19 ± 4 Gate III H2-GFP hi 44 ± 2 D EPCR Gate I H2-GFP neg ± 4 EPCR Gate II H2-GFP int ± 5 Gate III H2-GFP hi 29 ± 2 EPCR 29.8 Endoglin Endoglin Endoglin Supplementary Figure 9: CD34 expression and loss of EPCR correlate with loss of H2-GFP in + - L - K + S + HSCs. HSCs ( + - L - K + S + ) from bone marrow of H2-GFP mice 16 weeks after a doxycyline pulse were analyzed for H2-GFP expression () and the expression of CD34 14 (), EPCR 17 (C), and Endoglin 18 (D) was correlated with absence of H2-GFP (left panels), intermediate levels of H2-GFP (middle panels), and high levels of H2-GFP (right panels). Representative panels from three identical experiments are shown, numbers are averages ± standard deviations, n=3 for all panels. Note: there in a striking inverse correlation between CD34 expression and H2-GFP retention, and H2-GFP retention correlates with high EPCR levels. Endoglin shows no correlation with H2-GFP expression.
11 L - K + S + L - K + S ±2 78±7 57± CD34 L - K + S H2-GFP 84±2 57±2 24±1 EPCR H2-GFP Supplementary Figure 10: CD34 and EPCR enhance the correlation with H2-GFP retention in + - L - S + K + HSCs. HSCs ( + - L - K + S + ) from bone marrow of H2-GFP mice 16 weeks after a doxycyline pulse were analyzed for H2-GFP expression in combination with CD34 14 (upper panels) or EPCR 17 (lower panels). Grey shaded areas and grey numbers in right panels show fluorescence of the entire + - L - K + S + -population; red curves and numbers show fluorescence of CD34-negative (upper) or EPCR hi HSCs ( + - L - K + S + ). Numbers are averages ± standard deviations (n=3).
12 Online Supplement 12 Foudi et al II) Supplementary References 38. Kostetskii, I. et al. Induced deletion of the N-cadherin gene in the heart leads to dissolution of the intercalated disc structure. Circ Res 96, (2005). 39. Matsunami, H. & Takeichi, M. Fetal brain subdivisions defined by R- and E- cadherin expressions: evidence for the role of cadherin activity in region-specific, cell-cell adhesion. Dev iol 172, (1995). 40. Radice, G. L. et al. Developmental defects in mouse embryos lacking N-cadherin. Dev iol 181, (1997). 41. Ema, H., Takano, H., Sudo, K. & Nakauchi, H. In vitro self-renewal division of hematopoietic stem cells. J Exp Med 192, (2000). 42. Takano, H., Ema, H., Sudo, K. & Nakauchi, H. symmetric division and lineage commitment at the level of hematopoietic stem cells: inference from differentiation in daughter cell and granddaughter cell pairs. J Exp Med 199, (2004).
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior
Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell exterior Martin Gustavsson, David Hörnström, Susanna Lundh, Jaroslav Belotserkovsky, Gen Larsson
FETAL FIBROBLASTS, PASSAGE 10
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from fetal fibroblast passages 10, 14, 17, and 22 using barcoded hairpinbisulfite PCR. Fifteen L1 sequences were analyzed for passages
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6.
Methods S1. Sequences relevant to the constructed strains, Related to Figures 1-6. A. Promoter Sequences Gal4 binding sites are highlighted in the color referenced in Figure 1A when possible. Site 1: red,
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 207 Supplementary Information Experimental Identification and Computational Characterization of
Supporting Information for
Supporting Information for Analysis of Sogatella furcifera proteome that interact with P10 protein of Southern rice black-streaked dwarf virus Win Than*, Faliang Qin*, Wenwen Liu, Xifeng Wang ** State
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
I. Principles of Pointer Year Analysis
I. Principles of Pointer Year Analysis Fig 1. Maximum (red) and minimum (blue) pointer years. 1 Fig 2. Principle of pointer year calculation. Fig 3. Skeleton plot graph created by Kinsys/Kigraph programme.
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Title: Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae
Title: Enhancement of protein production via the strong DIT1 terminator and two RNA-binding proteins in Saccharomyces cerevisiae Authors: Yoichiro Ito, Takao Kitagawa, Mamoru Yamanishi, Satoshi Katahira,
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Strain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC
TABLE S1 Bacterial strains and plasmids Strain or plasmid Description a Reference or source b B. subtilis 168 trpc2 Laboratory stock 1A780 trpc2 sigb::spc BGSC BM1010 trpc2 htpx::pgs1582; Em r BM1302 trpc2
Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009
Plasmid Name: pmm290 Aliases: none known Length: 11707 bp Constructed by: Mike Moser/Cristina Swanson Last updated: 17 August 2009 Description and application: This is a mammalian expression vector for
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
S Sähkön jakelu ja markkinat S Electricity Distribution and Markets
S-18.3153 Sähkön jakelu ja markkinat S-18.3154 Electricity Distribution and Markets Voltage Sag 1) Kolmivaiheinen vastukseton oikosulku tapahtuu 20 kv lähdöllä etäisyydellä 1 km, 3 km, 5 km, 8 km, 10 km
Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa. Taustaa
Asiakaspalautteen merkitys laboratoriovirheiden paljastamisessa Paula Oja, TtT Laboratorio, Oulun yliopistollinen sairaala Potilasturvallisuustutkimuksen päivät 26. 27.1.2011 1 Taustaa Laboratorion tulee
Tilausvahvistus. Anttolan Urheilijat HENNA-RIIKKA HAIKONEN KUMMANNIEMENTIE 5 B RAHULA. Anttolan Urheilijat
7.80.4 Asiakasnumero: 3000359 KALLE MANNINEN KOVASTENLUODONTIE 46 51600 HAUKIVUORI Toimitusosoite: KUMMANNIEMENTIE 5 B 51720 RAHULA Viitteenne: Henna-Riikka Haikonen Viitteemme: Pyry Niemi +358400874498
Digital Admap Native. Campaign: Kesko supermarket
Digital Admap Native Campaign: Kesko supermarket Digital Admap Native Campaign: Kesko Supermarket Mainosmuoto: Natiivi Media: IS.fi Campaign period: 25 September Date of measurement: 26 September Unique:
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
Ajettavat luokat: SM: S1 (25 aika-ajon nopeinta)
SUPERMOTO SM 2013 OULU Lisämääräys ja ohje Oulun Moottorikerho ry ja Oulun Formula K-125ry toivottaa SuperMoto kuljettajat osallistumaan SuperMoto SM 2013 Oulu osakilpailuun. Kilpailu ajetaan karting radalla
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Data quality points. ICAR, Berlin,
Data quality points an immediate and motivating supervision tool ICAR, Berlin, 22.5.2014 Association of ProAgria Centres Development project of Milk Recording Project manager, Heli Wahlroos heli.wahlroos@proagria.fi
EUROOPAN PARLAMENTTI
EUROOPAN PARLAMENTTI 2004 2009 Kansalaisvapauksien sekä oikeus- ja sisäasioiden valiokunta 2008/0101(CNS) 2.9.2008 TARKISTUKSET 9-12 Mietintöluonnos Luca Romagnoli (PE409.790v01-00) ehdotuksesta neuvoston
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine
Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
Läpimurto ms-taudin hoidossa?
Läpimurto ms-taudin hoidossa? Läpimurto ms-taudin hoidossa? Kansainvälisen tutkijaryhmän kliiniset kokeet uudella lääkkeellä antoivat lupaavia tuloksia sekä aaltoilevan- että ensisijaisesti etenevän ms-taudin
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
Tree map system in harvester
Tree map system in harvester Fibic seminar 12.6.2013 Lahti Timo Melkas, Metsäteho Oy Mikko Miettinen, Argone Oy Kalle Einola, Ponsse Oyj Project goals EffFibre project 2011-2013 (WP3) To evaluate the accuracy
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
Perhevapaiden palkkavaikutukset
Perhevapaiden palkkavaikutukset Perhe ja ura tasa-arvon haasteena seminaari, Helsinki 20.11.2007 Jenni Kellokumpu Esityksen runko 1. Tutkimuksen tavoite 2. Teoria 3. Aineisto, tutkimusasetelma ja otos
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine Centre for Language and Communication Studies
Information on Finnish Language Courses Spring Semester 2018 Päivi Paukku & Jenni Laine 4.1.2018 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve
Supporting information
Supporting information Figure S1. Carotenoid biosynthesis pathway in papaya fruit which is adopted from Blas et al. (2010) (reference 4) and Nisar et al. (2015) (reference 5). Carotenoids are synthesized
Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)
Tilasto T1106120-s2012palaute Kyselyn T1106120+T1106120-s2012palaute yhteenveto: vastauksia (4) Kysymys 1 Degree programme: (4) TIK: TIK 1 25% ************** INF: INF 0 0% EST: EST 0 0% TLT: TLT 0 0% BIO:
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)
Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ
Puhe ja kieli, 27:4, 141 147 (2007) 3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Soile Loukusa, Oulun yliopisto, suomen kielen, informaatiotutkimuksen ja logopedian laitos & University
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the
FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL
FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ
KONEISTUSKOKOONPANON TEKEMINEN NX10-YMPÄRISTÖSSÄ https://community.plm.automation.siemens.com/t5/tech-tips- Knowledge-Base-NX/How-to-simulate-any-G-code-file-in-NX- CAM/ta-p/3340 Koneistusympäristön määrittely
Salasanan vaihto uuteen / How to change password
Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change
Small Number Counts to 100. Story transcript: English and Blackfoot
Small Number Counts to 100. Story transcript: English and Blackfoot Small Number is a 5 year-old boy who gets into a lot of mischief. He lives with his Grandma and Grandpa, who patiently put up with his
Curriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
Statistical design. Tuomas Selander
Statistical design Tuomas Selander 28.8.2014 Introduction Biostatistician Work area KYS-erva KYS, Jyväskylä, Joensuu, Mikkeli, Savonlinna Work tasks Statistical methods, selection and quiding Data analysis
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 81122P (4 ov.) 30.5.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
Satelliittikuvat osana öljypäästövalvontaa
Öljypäästövalvonta Euroopan meriturvallisuusviraston (EMSA) satelliittikuvilta Kati Tahvonen Suomen ympäristökeskus Kaukokartoituspäivät 2007 Helsinki, 8.11.2007 Satelliittikuvat osana öljypäästövalvontaa
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
PAINEILMALETKUKELA-AUTOMAATTI AUTOMATIC AIR HOSE REEL
MAV4 MAV5 MAV6 PAINEILMALETKUKELA-AUTOMAATTI AUTOMATIC AIR HOSE REEL Käyttöohje Instruction manual HUOMIO! Lue käyttöohjeet huolellisesti ennen laitteen käyttöä ja noudata kaikkia annettuja ohjeita. Säilytä
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
Asuntoreformi 2018
SUOMEN ARKKITEHTILIITTO F I N L A N D S A R K I T E K T FÖRBUND FINNISH ASSOCIATION OF ARCHITECTS 4.6.2018 To reformist@eclipso.eu Thank you for contacting the Finnish Association of Architects SAFA regarding
COXAN PULSSI. Tuula Rantala Hoitotyön johtaja Ylpeys omasta työstä ja yhteishenki ovat tekemisen lähtökohtia.
COXAN PULSSI Tuula Rantala Hoitotyön johtaja 22.10.2014 Ylpeys omasta työstä ja yhteishenki ovat tekemisen lähtökohtia. COXAN PULSSI Mittaa sekä kovia että pehmeitä arvoja ja niiden yhteisvaikutusta Liikennevalokäytäntö;
Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ
Biojätteen keruu QuattroSelect - monilokerojärjestelmällä 21.10.2015 Tiila Korhonen SUEZ Agenda 1 SITA Suomi on SUEZ 2 QS, mikä se on? 3 QS maailmalla 4 QS Suomessa 5 QS Vaasassa SITA Suomi Oy ja kaikki
Vakiomallisten kuumakanavajärjestelmien kytkeminen Wiring of standard hotrunner systems
Teknillinen dokumentaatio Technical documentation E. Vakiomallisten kuumakanavajärjestelmien kytkeminen Wiring of standard hotrunner systems Version.0 ! Tärkeä turvaohje / Important safety instruction
S-55.1100 SÄHKÖTEKNIIKKA JA ELEKTRONIIKKA
S-55.00 SÄHKÖKNKKA A KONKKA. välikoe 2..2008. Saat vastata vain neljään tehtävään!. aske jännite U. = 4 Ω, 2 = Ω, = Ω, = 2, 2 =, = A, 2 = U 2 2 2 2. ännitelähde tuottaa hetkestä t = t < 0 alkaen kaksiportaisen
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
Increase of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
Työmaadoitusvälineet suurjännitteelle
Työmaadoitusvälineet suurjännitteelle Eurolaite Oy on vuonna 1 perustettu sähkötekniikan tuotteiden maahantuontiin, markkinointiin ja myyntiin erikoistunut asiantuntijayritys. Keskeisenä tavoitteena on
NAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita
NAO- ja ENO-osaamisohjelmien loppuunsaattaminen ajatuksia ja visioita NAO-ENO työseminaari VI Tampere 3.-4.6.2015 Projektisuunnittelija Erno Hyvönen erno.hyvonen@minedu.fi Aikuiskoulutuksen paradigman
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija
Infrastruktuurin asemoituminen kansalliseen ja kansainväliseen kenttään Outi Ala-Honkola Tiedeasiantuntija 1 Asemoitumisen kuvaus Hakemukset parantuneet viime vuodesta, mutta paneeli toivoi edelleen asemoitumisen
812336A C++ -kielen perusteet, 21.8.2010
812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys
OFFICE 365 OPISKELIJOILLE
OFFICE 365 OPISKELIJOILLE Table of Contents Articles... 3 Ohjeet Office 365 käyttöönottoon... 4 One Driveen tallennetun videon palauttaminen oppimisympäristön palautuskansioon... 5 Changing default language
toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous
Tuula Sutela toukokuu 2011: Lukion kokeiden kehittämistyöryhmien suunnittelukokous äidinkieli ja kirjallisuus, modersmål och litteratur, kemia, maantiede, matematiikka, englanti käsikirjoitukset vuoden
Pricing policy: The Finnish experience
Pricing policy: The Finnish experience Esa Österberg Senior Researcher Alcohol and Drug Research, STAKES, Helsinki, Finland esa.osterberg@stakes.fi Three pillars of traditional Nordic alcohol control Strict
Särmäystyökalut kuvasto Press brake tools catalogue
Finnish sheet metal machinery know-how since 1978 Särmäystyökalut kuvasto Press brake tools catalogue www.aliko.fi ALIKO bending chart Required capacity in kn (T) in relation to V-opening. V R A S = plates
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK
Opiskelijoiden ajatuksia koulun alkuun liittyen / students thoughts about the beginning of their studies at KSYK Helppoa/mukavaa/palkitsevaa - easy/nice/rewarding - uudet ystävät/ new friends - koulun
Ikärakennemuutos, tulot ja kulutus Reijo Vanne, Työeläkevakuuttajat TELA. Sisältö. Päälähteet
Helsingin yliopisto Sosiaalitieteiden laitos Yhteiskuntapolitiikka Luentosarja: Suomi ikääntyy 2015 19.2.2015 Ikärakennemuutos, tulot ja kulutus Reijo Vanne, Työeläkevakuuttajat TELA Sisältö Käsitteitä:
Rekisteröiminen - FAQ
Rekisteröiminen - FAQ Miten Akun/laturin rekisteröiminen tehdään Akun/laturin rekisteröiminen tapahtuu samalla tavalla kuin nykyinen takuurekisteröityminen koneille. Nykyistä tietokantaa on muokattu niin,
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement
Innovative and responsible public procurement Urban Agenda kumppanuusryhmä https://ec.europa.eu/futurium/en/ public-procurement Julkiset hankinnat liittyvät moneen Konsortio Lähtökohdat ja tavoitteet Every
AYYE 9/ HOUSING POLICY
AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we
Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi.
SOSIAALINEN MEDIA Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi. FACEBOOK Facebook mahdollistaa useiden erilaisten Social plugins -toimintojen
DIGITAL MARKETING LANDSCAPE. Maatalous-metsätieteellinen tiedekunta
DIGITAL MARKETING LANDSCAPE Mobile marketing, services and games MOBILE TECHNOLOGIES Handset technologies Network technologies Application technologies INTRODUCTION TO MOBILE TECHNOLOGIES COMPANY PERSPECTIVE
4x4cup Rastikuvien tulkinta. 4x4cup Control point picture guidelines
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen, että rastikuvissa näkyy selvästi että kilpailija koskee
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE
Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University
FYSE301(Elektroniikka(1(A3osa,(kevät(2013(
FYSE301(Elektroniikka(1(A3osa,(kevät(2013( 1/2 Loppukoe1.3.2013 vastaakaikkiinkysymyksiin(yhteensä48pistettä) 1. Kuvailelyhyesti a. Energialineaarisissapiirielementeissä:vastuksessa,kondensaattorissajakelassa(3
Travel Getting Around
- Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies
Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!
Eija Lahtinen Uudet kelikamerat Kaakkois-Suomen tiepiiri
Eija Lahtinen Uudet kelikamerat Kaakkois-Suomen tiepiiri VIKING Eija Lahtinen Uudet kelikamerat Kaakkois-Suomen tiepiiri Tiehallinto Kaakkois-Suomen tiepiiri Liikenteen palvelut Kouvola 2001 Raportin
Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe
etu Monikäyttöpaperi hoitaa useimmat pyyhintätehtävät Sopiva lasipintojen pyyhintään Sopii käsien kuivaamiseen Elintarvikekäyttöön hyväksytty Tork Easy Handling, pakkaus, jota on helppo kantaa mukana,