Kari Kinnunen: A phosphorus retention model
|
|
- Kari Alanen
- 8 vuotta sitten
- Katselukertoja:
Transkriptio
1 VESIENTUTKIMUSLAITOKSEN JULKAISUJA PUBLICATIONS OF THE WATER RESEARCH INSTITUTE Guy Hällfors: A preliminary check-list of the phytoplankton of the northern Baltic Sea Tiivistelmä: Alustava pohjoisen Itämeren kasviplanktonluettelo Guy Hällfors, Terttu Melvasalo, Ake Niemi fixatives and preservatives on phytoplankton counts Hilkka Viljamaa: Effect of different Tiivistelmä: Erilaisten säilöntäaineiden vaikutus kasviplanktonin laskentatuloksiin 25 Lea Kauppi: Phosphorus and nitrogen input from rural population, agriculture and forest fertilization to watercourses Tiivistelmä: Haja-asutuksesta. maanviljelystä ja metsänlannoituksesta aiheutuva fostori- ja typpikuorma 35 3 llppo Kettunen: Horizontal differences in water quality in an area of Lake Saimaa polluted by waste waters Tiivistelmä: Veden laadun horisontaaliset erot jätevesien pilaamalla vesialueella Saimaalla 47 Tellervo Kylä-Harakka: Application of the Streeter-Phelps model to the Äänekoski watercourse, Central Finland Tiivistelmä: Streeter-Phelps-mallin soveltaminen Äänekosken vesireitille 52 KalleMatti Lappalainen, Jorma Niemi and its application to Lake Päijänne Kari Kinnunen: A phosphorus retention model Tiivistelmä: Fosforimalli ja sen soveltaminen Päijänteeseen 60 Maarit Niemi Jorma Niemi: Diurnal variation of bacteria and bacteriophages in sewage effluent and the flow time of sewage through a treatment plant Tiivistelmä: Bakteerien ja bakteriofaagien esiintyminen puhdistetussa jätevedessä vuorokauden aikana ja puhdistamon viipymän määrittäminen 68 Titta Ojanen: Phosphorus and nitrogen balance of the eutrophic Lake Tuusulanjärvi Tiivistelmä: Tuusulanjärven typpi- ja fosforitase 74 Ilkka Rinne, Terttu Melvasalo, Ake Niemi Lauri Niemistö: Nitrogenfixation (acetylene reduction method) by blue-green algae in the Baltic Sea in 1975 and 1977 Tiivistelmä: Sinilevien typensidonta Itämeressä 1975 ja Matti Verta, Veijo Miettinen Kirsti Erkomaa: Concentrations of chlorinated hydro carbons in pike from the Turku archipelago in the years Tiivistelmä: Kloorattujen hiilivetyjen pitoisuuksista Turun saariston hauissa vuosina VESIHALLITUS NATIONAL BOARD OF WATERS, FINLAND Helsinki 1979
2 ISBN SSN Helsinki Valtion psinatuskeskus
3 47 HORIZONTAL DIFFERENCES IN WATER QUALJTY IN AN AREA OF LAKE SAIMAA POLLUTED BY WASTE WATERS lippo Kettunen KETTUNEN, Horizontal differences in water quality in an area of Lake Saimaa polluted by waste waters. Publications of the Water Research Institute, National Board of Waters, Finland, No. 34. An investigation carried out in a part of Lake Saimaa affected by waste waters from cellulose factory indicated that the quality of littoral water differed considerably from that of the main body of water. The mostmarked differences were in oxygen concentrations, which varied from 5.4 mg 1 1 in littoral water to 1.9 mgl in the open lake. When planning investigations of polluted waters the possibile occurrance of such horizontal differences should be taken into consideration. Index words: Water quality, horizontal differences, pollution. 1. INTRODUCTION The true residence time of water in chains of lakes is often considerably less than that cal culated on the basis of lake volume (Kettunen 1971). The effects of waste waters therefore extend further down the watercourse than dilution calculations indicate. Waste materiais carried by the stream may for the same reason be more raw, with correspondingly greater effect on water quality, in ehain lakes with a strong current than in solitary lakes situated apart from the mainstream of water movement. 2. METHODS In an investigation carried out in June 1973 water quality was examined from three sam pling lines, in the southern region of Lake Sai maa, along the route followed by waste waters emitted by the factory of Kaukas Oy (Fig. 1). In addition one sampling line was chosen in a non-polluted area of Greater Saimaa. Water quality from each point of sampling was examined by means of a vertical series of water sampies. The sampies were analysed in the laboratory of National Board of Waters Kymi district office
4 using methods conforming to SFS standards. The results are presented as profile figures. The water region being investigated was polluted by waste waters from forest industries. Oxygen concentra tions in the water occasionally feil to below the tolerance threshold of fish populations, with consequent death of the fishes. 3. RESULTS Fig. 1. The southern region of Lake Saimaa. The sampling line A (Murheistenranta) was situated in a polluted littoral zone about 3 km from an effluent discharge point. The oxygen concentration of water very close to the shore was found to be 5.4 mg i, while 300 m from the shore concentrations were only 1.9 and 2.2 mg 1 1 in surface layers and deeper water, respectively (Fig. 2). Results from the sampling line B (Riutansal mi) showed that the most strongly polluted water was at a depth of 3 5 m (Figs. 3 and 4). Sampling line C (Kauraniemenlahti) presents a closed, eutrophic bay. lncreased oxygen con centration and turbidity recorded in the centre of the bay were probably the resuit of aigal growth (Figs. 5 and 6). Sampling line D, in a non-polluted area of Lake Saimaa, was situated in the comparatively open bay of Leviäsaari (Figs. 7 and 8). In the more eutrophic region near to the shore COD values were considerably higher than in the open lake. 0 m 1,0 2,0 3,0 =11 5, m 5 Distonce Oxygeri mg/t < 2.0 2,0 2,5 2,5 3.0 m 3,0 6,0 > 4,0 Fig. 2. Oxygen concentration. Sampling line A.
5 49 0 m xyger 2 mg/l :: 2,0 3,0 Distance 1.0 2,0 <1,0 Fig. 3. Oxygen concentration. Sampling line B. 0 m C0D Fig. 4. Chemical Oxygen m169 Demand >20 (COD). Sampling line B. Distance DISCUSSION The research carried out shows that a water mass may be divided into areas of different quality in a rather exceptional manner. The boundaries of stratified water leveis are determined by prevailing currents. In polluted areas stratification may also be due to the difference in density between effluent and non-polluted lake water. This has the effect that the effluent does not readily become diluted in the main body of water, but develops instead its own path of flow through the lake. This is clearly noticable in narrow sounds typical of the southern region of Lake Saimaa (Heinonen, Aihonen and Kettunen 1971). The present research also showed that vertical water quality boundaries do not approach the shore rectilinearly but rather follow the rising of V 13
6 Depth Depth :** 1 A;OOOOI1/1 it z c. O 1
7 51 the lake bottom towards the shore. in the shallow water near the shore photosynthetic and biodegrading activity have water quality. a particular effect on keessä oli liuenneen hapen määrä lähes kolmin kertainen verrattuna päällysveden arvoihin järven syvemmillä alueilla. LOPPUTI VISTELMÅ REFERENCES Veden laadun horisontaalisia eroja on tutkittu Etelä-Saimaalla selluteollisuuden pahoin likaa maila vesistöalueella. Merkittävimmät erot on havaittu happipitoisuudessa. Litoraalivyöhyk Heinonen, P., P. den taivisesta kerrostun-iisesta vialtajssa. Vesitalous veden järvessä. Vesitalous 5: Kettunen, Aihonen, Kettunen, hitaasti Havaintoja virtaavjssa Jäteve jär virtauksista reitti
1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward.
START START SIT 1. SIT. The handler and dog stop with the dog sitting at heel. When the dog is sitting, the handler cues the dog to heel forward. This is a static exercise. SIT STAND 2. SIT STAND. The
VESIENTUTKIMUSLAITOKSEN JULKAISUJA PUBLICATIONS OF THE WATER RESEARCH INSTJTUTE
VESIENTUTKIMUSLAITOKSEN JULKAISUJA PUBLICATIONS OF THE WATER RESEARCH INSTJTUTE Erkki Alasaarela: Acidity problems caused by flood control works of the river Kyrönjoki Tiivistelmä: Kyrönjoen tulvasuojelutöiden
Results on the new polydrug use questions in the Finnish TDI data
Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007
National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007 Chapter 2.4 Jukka Räisä 1 WATER PIPES PLACEMENT 2.4.1 Regulation Water pipe and its
Capacity Utilization
Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
16. Allocation Models
16. Allocation Models Juha Saloheimo 17.1.27 S steemianalsin Optimointiopin seminaari - Sks 27 Content Introduction Overall Efficienc with common prices and costs Cost Efficienc S steemianalsin Revenue
S Sähkön jakelu ja markkinat S Electricity Distribution and Markets
S-18.3153 Sähkön jakelu ja markkinat S-18.3154 Electricity Distribution and Markets Voltage Sag 1) Kolmivaiheinen vastukseton oikosulku tapahtuu 20 kv lähdöllä etäisyydellä 1 km, 3 km, 5 km, 8 km, 10 km
Efficiency change over time
Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel
Exercise 1. (session: )
EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You
KMTK lentoestetyöpaja - Osa 2
KMTK lentoestetyöpaja - Osa 2 Veijo Pätynen 18.10.2016 Pasila YHTEISTYÖSSÄ: Ilmailun paikkatiedon hallintamalli Ilmailun paikkatiedon hallintamalli (v0.9 4.3.2016) 4.4 Maanmittauslaitoksen rooli ja vastuut...
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region
The BaltCICA Project Climate Change: Impacts, Costs and Adaptation in the Baltic Sea Region The BaltCICA Project is designed to focus on the most imminent problems that climate change is likely to cause
The Viking Battle - Part Version: Finnish
The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman
Gap-filling methods for CH 4 data
Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling
AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY
T032/M27/2019 Liite 1 / Appendix 1 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY SAIMAAN VESI- JA YMPÄRISTÖTUTKIMUS OY WATER AND ENVIRONMENT RESEARCH OF SAIMAA Tunnus Code
FIS IMATRAN KYLPYLÄHIIHDOT Team captains meeting
FIS IMATRAN KYLPYLÄHIIHDOT 8.-9.12.2018 Team captains meeting 8.12.2018 Agenda 1 Opening of the meeting 2 Presence 3 Organizer s personell 4 Jury 5 Weather forecast 6 Composition of competitors startlists
AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY
T032/M24/2016 Liite 1 / Appendix 1 Sivu / Page 1(5) AKKREDITOITU TESTAUSLABORATORIO ACCREDITED TESTING LABORATORY SAIMAAN VESI- JA YMPÄRISTÖTUTKIMUS OY WATER AND ENVIRONMENT RESEARCH OF SAIMAA Tunnus Code
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)
On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs
anna minun kertoa let me tell you
anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta
C++11 seminaari, kevät Johannes Koskinen
C++11 seminaari, kevät 2012 Johannes Koskinen Sisältö Mikä onkaan ongelma? Standardidraftin luku 29: Atomiset tyypit Muistimalli Rinnakkaisuus On multicore systems, when a thread writes a value to memory,
Accommodation statistics
Transport and Tourism 2011 Accommodation statistics 2011, January Nights spent by foreign tourists in Finland increased by per cent in January The number of recorded nights spent by foreign tourists at
Other approaches to restrict multipliers
Other approaches to restrict multipliers Heikki Tikanmäki Optimointiopin seminaari 10.10.2007 Contents Short revision (6.2) Another Assurance Region Model (6.3) Cone-Ratio Method (6.4) An Application of
Returns to Scale II. S ysteemianalyysin. Laboratorio. Esitelmä 8 Timo Salminen. Teknillinen korkeakoulu
Returns to Scale II Contents Most Productive Scale Size Further Considerations Relaxation of the Convexity Condition Useful Reminder Theorem 5.5 A DMU found to be efficient with a CCR model will also be
7.4 Variability management
7.4 Variability management time... space software product-line should support variability in space (different products) support variability in time (maintenance, evolution) 1 Product variation Product
I. Principles of Pointer Year Analysis
I. Principles of Pointer Year Analysis Fig 1. Maximum (red) and minimum (blue) pointer years. 1 Fig 2. Principle of pointer year calculation. Fig 3. Skeleton plot graph created by Kinsys/Kigraph programme.
Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds
PhD Anne Hemmi 14.2.2013 RRR 2013 Conference in Greifswald, Germany Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds Eutrophication in surface waters High nutrient
MIKES, Julkaisu J3/2000 MASS COMPARISON M3. Comparison of 1 kg and 10 kg weights between MIKES and three FINAS accredited calibration laboratories
MITTATEKNIIKAN KESKUS CENTRE FOR METROLOGY AND ACCREDITATION Julkaisu J3/2000 MASS COMPARISON M3 Comparison of 1 kg and 10 kg weights between MIKES and three FINAS accredited calibration laboratories Kari
tgg agg Supplementary Figure S1.
ttaggatattcggtgaggtgatatgtctctgtttggaaatgtctccgccattaactcaag tggaaagtgtatagtaatgaatctttcaagcacacagatcacttcaaaagactgtttcaa catcacctcaggacaaaaagatgtactctcatttggatgctgtgatgccatgggtcacag attgcaattcccaagtgcccgttcttttacaccaaaatcaaagaagaatatctccccttt
Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi
Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi
Toimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II)
Toimintamallit happamuuden ennakoimiseksi ja riskien hallitsemiseksi turvetuotantoalueilla (Sulfa II) Happamuuskuormituksen ennustaminen valuma-aluetasolla Marie Korppoo ja Markus Huttunen 13.5.2019 Päämäärä
Phytoplankton quality element in the classification of Finnish lakes present status and future plans
Phytoplankton quality element in the classification of Finnish lakes present status and future plans Marko Järvinen Finnish Environment Institute SYKE Jyväskylä Office Photo: M. Järvinen Nordic WFD workshop
( ,5 1 1,5 2 km
Tuulivoimala Rakennukset Asuinrakennus Liikerak. tai Julkinen rak. Lomarakennus Teollinen rakennus Kirkollinen rakennus Varjostus "real case" h/a 1 h/a 8 h/a 20 h/a 4 5 3 1 2 6 7 8 9 10 0 0,5 1 1,5 2 km
KYMENLAAKSO- FINLAND S LOGISTICS CENTRE- REGION OF OPPORTUNITIES Kai Holmberg, NELI-North European Logistics Institute RIGA 20.04.
KYMENLAAKSO- FINLAND S LOGISTICS CENTRE- REGION OF OPPORTUNITIES Kai Holmberg, NELI-North European Logistics Institute RIGA 20.04.2010 20.7.2012 Finland Land of A Thousand Lakes 187,888 lakes 5,100 rapids
3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ
Puhe ja kieli, 27:4, 141 147 (2007) 3 9-VUOTIAIDEN LASTEN SUORIUTUMINEN BOSTONIN NIMENTÄTESTISTÄ Soile Loukusa, Oulun yliopisto, suomen kielen, informaatiotutkimuksen ja logopedian laitos & University
Alternative DEA Models
Mat-2.4142 Alternative DEA Models 19.9.2007 Table of Contents Banker-Charnes-Cooper Model Additive Model Example Data Home assignment BCC Model (Banker-Charnes-Cooper) production frontiers spanned by convex
Pyhäjärven suojeluohjelma Ajankohtaista 01/2018
Pyhäjärven suojeluohjelma Ajankohtaista 01/2018 Pyhäjärvi-instituutti, Sepäntie 7, 27500 Kauttua 0440 344 054, www.pyhajarvi-instituutti.fi, @PJinstituutti Kuva: Leena Kirsti Juusela, FB Käynnissä
Hankkeen toiminnot työsuunnitelman laatiminen
Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa
Mitattua tutkimustietoa ekosysteemipalveluista metropolialueen kestävän kasvun tueksi (EKO-HYÖTY)
Mitattua tutkimustietoa ekosysteemipalveluista metropolialueen kestävän kasvun tueksi (EKO-HYÖTY) Heikki Setälä, Vesa Yli-Pelkonen, Viljami Viippola ym. Helsingin yliopisto, Ympäristötieteiden laitos www.helsinki.fi/yliopisto
Plant protection of cereals current situation
Plant protection of cereals current situation PesticideLife Opening seminar 19.2.2010, Jokioinen Pertti Rajala Cereals, total 1 203,1 Winter wheat 16,4 Spring wheat 201,9 Winter rye 11,3 Sring rye 5,1
1.3 Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä
OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 811122P (5 op.) 12.12.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan
LYTH-CONS CONSISTENCY TRANSMITTER
LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are
Use of spatial data in the new production environment and in a data warehouse
Use of spatial data in the new production environment and in a data warehouse Nordic Forum for Geostatistics 2007 Session 3, GI infrastructure and use of spatial database Statistics Finland, Population
RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla
TURUN YLIOPISTO Hoitotieteen laitos RANTALA SARI: Sairaanhoitajan eettisten ohjeiden tunnettavuus ja niiden käyttö hoitotyön tukena sisätautien vuodeosastolla Pro gradu -tutkielma, 34 sivua, 10 liitesivua
The CCR Model and Production Correspondence
The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls
HARJOITUS- PAKETTI A
Logistiikka A35A00310 Tuotantotalouden perusteet HARJOITUS- PAKETTI A (6 pistettä) TUTA 19 Luento 3.Ennustaminen County General 1 piste The number of heart surgeries performed at County General Hospital
make and make and make ThinkMath 2017
Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus
Bounds on non-surjective cellular automata
Bounds on non-surjective cellular automata Jarkko Kari Pascal Vanier Thomas Zeume University of Turku LIF Marseille Universität Hannover 27 august 2009 J. Kari, P. Vanier, T. Zeume (UTU) Bounds on non-surjective
Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes)
SYLY- päivät 2014 Helsinki 28.11.2014 Perusterveydenhuollon erilaisten diabeteksen hoitomallien tuloksellisuuden vertailu (painopisteenä tyypin 1 diabetes) Diabeteslääkäri Mikko Honkasalo Nurmijärven terveyskeskus
MUSEOT KULTTUURIPALVELUINA
Elina Arola MUSEOT KULTTUURIPALVELUINA Tutkimuskohteena Mikkelin museot Opinnäytetyö Kulttuuripalvelujen koulutusohjelma Marraskuu 2005 KUVAILULEHTI Opinnäytetyön päivämäärä 25.11.2005 Tekijä(t) Elina
SAGA 150. Asennusohjeet. Mittaa oven korkeus. Piirrä seinään oven kiinni -päätyyn seinäkannattimen kohdalle vaakaviiva korkeudelle ovi + 75mm + 20 mm.
SAGA 150 Asennusohjeet 500 1 2 Mittaa oven korkeus. Piirrä seinään oven kiinni -päätyyn seinäkannattimen kohdalle vaakaviiva korkeudelle ovi + 75mm + 20 mm. 3 Piirrä vesivaa an avulla viiva myös kiskon
WindPRO version joulu 2012 Printed/Page :42 / 1. SHADOW - Main Result
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 13.6.2013 19:42 / 1 Minimum
Tork Paperipyyhe. etu. tuotteen ominaisuudet. kuvaus. Väri: Valkoinen Malli: Vetopyyhe
etu Monikäyttöpaperi hoitaa useimmat pyyhintätehtävät Sopiva lasipintojen pyyhintään Sopii käsien kuivaamiseen Elintarvikekäyttöön hyväksytty Tork Easy Handling, pakkaus, jota on helppo kantaa mukana,
Curriculum. Gym card
A new school year Curriculum Fast Track Final Grading Gym card TET A new school year Work Ethic Detention Own work Organisation and independence Wilma TMU Support Services Well-Being CURRICULUM FAST TRACK
( ( OX2 Perkkiö. Rakennuskanta. Varjostus. 9 x N131 x HH145
OX2 9 x N131 x HH145 Rakennuskanta Asuinrakennus Lomarakennus Liike- tai julkinen rakennus Teollinen rakennus Kirkko tai kirkollinen rak. Muu rakennus Allas Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 2 km
Tynnyrivaara, OX2 Tuulivoimahanke. ( Layout 9 x N131 x HH145. Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a
, Tuulivoimahanke Layout 9 x N131 x HH145 Rakennukset Asuinrakennus Lomarakennus 9 x N131 x HH145 Varjostus 1 h/a 8 h/a 20 h/a 0 0,5 1 1,5 km 2 SHADOW - Main Result Assumptions for shadow calculations
Increase of opioid use in Finland when is there enough key indicator data to state a trend?
Increase of opioid use in Finland when is there enough key indicator data to state a trend? Martta Forsell, Finnish Focal Point 28.9.2015 Esityksen nimi / Tekijä 1 Martta Forsell Master of Social Sciences
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland
Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research
Lataa SETI Revisited - Risto Isomäki. Lataa
Lataa SETI Revisited - Risto Isomäki Lataa Kirjailija: Risto Isomäki ISBN: 9789522648457 Sivumäärä: 100 Formaatti: PDF Tiedoston koko: 20.51 Mb In his newest book Risto Isomäki argues that instead of only
Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä
Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?
Stormwater filtration unit
Stormwater filtration unit Background, concept and applied design work Olli Hakala 2018 WSP Finland Aalto university Kyttä ym. 2014. Veden äärellä kysely, ENTJUSTESS-hanke. Aalto yliopisto. STORMWATER
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel. Kalle Lehto, Aalto-yliopisto 5.5.
ReFuel 70 % Emission Reduction Using Renewable High Cetane Number Paraffinic Diesel Fuel Kalle Lehto, Aalto-yliopisto 5.5.2011 Otaniemi ReFuel a three year research project (2009-2011) goal utilize the
Export Demand for Technology Industry in Finland Will Grow by 2.0% in 2016 GDP growth 2016/2015, %
Russia Rest of Eastern Europe Brazil America Middle East and Africa Export Demand for Technology Industry in Finland Will Grow by 2.% in 216 GDP growth 216/215, % 9 8 7 6 5 4 3 2 1-1 -2-3 -4 Average growth:
Metsälamminkankaan tuulivoimapuiston osayleiskaava
VAALAN KUNTA TUULISAIMAA OY Metsälamminkankaan tuulivoimapuiston osayleiskaava Liite 3. Varjostusmallinnus FCG SUUNNITTELU JA TEKNIIKKA OY 12.5.2015 P25370 SHADOW - Main Result Assumptions for shadow calculations
The role of 3dr sector in rural -community based- tourism - potentials, challenges
The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences
LX 70. Ominaisuuksien mittaustulokset 1-kerroksinen 2-kerroksinen. Fyysiset ominaisuudet, nimellisarvot. Kalvon ominaisuudet
LX 70 % Läpäisy 36 32 % Absorptio 30 40 % Heijastus 34 28 % Läpäisy 72 65 % Heijastus ulkopuoli 9 16 % Heijastus sisäpuoli 9 13 Emissiivisyys.77.77 Auringonsuojakerroin.54.58 Auringonsäteilyn lämmönsiirtokerroin.47.50
Huleveden pitoisuuksien ajallinen ja alueellinen vaihtelu Maija Taka University of Helsinki 1
Huleveden pitoisuuksien ajallinen ja alueellinen vaihtelu 8.12.2014 Maija Taka University of Helsinki 1 Pienvesitutkimus pääkaupunkiseudulla 1. Alueellisesti kattava aineisto 2. Aikasarjatutkimus 3. Muu
Research plan for masters thesis in forest sciences. The PELLETime 2009 Symposium Mervi Juntunen
Modelling tree and stand characteristics and estimating biomass removals and harvesting costs of lodgepole pine (Pinus contorta) plantations in Iceland Research plan for masters thesis in forest sciences
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli. Lataa
Lataa Cognitive Function in Opioid Substitution Treated Patiens - Pekka Rapeli Lataa Kirjailija: Pekka Rapeli ISBN: 9789523022232 Sivumäärä: 173 Formaatti: PDF Tiedoston koko: 11.54 Mb Opioid substitution
Digital Admap Native. Campaign: Kesko supermarket
Digital Admap Native Campaign: Kesko supermarket Digital Admap Native Campaign: Kesko Supermarket Mainosmuoto: Natiivi Media: IS.fi Campaign period: 25 September Date of measurement: 26 September Unique:
MALE ADULT FIBROBLAST LINE (82-6hTERT)
Double-stranded methylation patterns of a 104-bp L1 promoter in DNAs from male and female fibroblasts, male leukocytes and female lymphoblastoid cells using hairpin-bisulfite PCR. Fifteen L1 sequences
Information on preparing Presentation
Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto
VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat
Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät
VESIENTUTKIMUSLAITOKSEN JULKAISUJA PUBLICATIONS OF THE WATER RESEARCH INSTITUTE
VESIENTUTKIMUSLAITOKSEN JULKAISUJA PUBLICATIONS OF THE WATER RESEARCH INSTITUTE Ilkka Isotalo: Concentrations and Ioads of some metais and fluorine in the River Kokemäenjoki in 1975 and 1977 Tiivistelmä:
ACTA FORESTALIA FENNICA
ACTA FORESTALIA FENNICA Voi. 137, 1974 Bacteria isolated from injuries to growing spruce trees (Picea abies (L.) Karst.) Kasvavien kuusien vaurioista eristetyt bakteerit Tauno Kallio SUOMEN METSÄTIETEELLINEN
TEST REPORT Nro VTT-S Air tightness and strength tests for Furanflex exhaust air ducts
TEST REPORT Nro VTT-S-04515-08 19.5.008 Air tightness and strength tests for Furanflex exhaust air ducts Requested by: Hormex Oy TEST REPORT NRO VTT-S-04515-08 1 () Requested by Order Hormex Oy Linnanherrankuja
Jäteveden denitrifikaation lisääminen ja vesistöhaittojen vähentäminen sedimenttidiffuusorin avulla
LIFE12 ENV/FI/597 2013-2017 Jäteveden denitrifikaation lisääminen ja vesistöhaittojen vähentäminen sedimenttidiffuusorin avulla Marja Tiirola Limnologipäivät 10.4.2017 N-SINK o Reduction of waste water
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
MEETING PEOPLE COMMUNICATIVE QUESTIONS
Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.
Matching in structural change area. Olli Retulainen 19.8.2015
Matching in structural change area Olli Retulainen 19.8.2015 Background Muuttuva Salo case study of Nokia plant closing in Salo -research project. Aim of this research project is to examine, in both quantitative
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
Harjavallan sulaton raskasmetallipäästöt
Mg vuodessa 25 2 15 Harjavallan sulaton raskasmetallipäästöt Cu Ni Zn Pb 1 5 1985 1988 1991 1994 1997 2 23 Outokumpu Oy Keskimääräinen vuosilaskeuma Harjavallan tutkimusgradientilla vuosina 1992-1998 7
Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen
The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project
Valuation of Asian Quanto- Basket Options
Valuation of Asian Quanto- Basket Options (Final Presentation) 21.11.2011 Thesis Instructor and Supervisor: Prof. Ahti Salo Työn saa tallentaa ja julkistaa Aalto-yliopiston avoimilla verkkosivuilla. Muilta
,0 Yes ,0 120, ,8
SHADOW - Main Result Calculation: Alue 2 ( x 9 x HH120) TuuliSaimaa kaavaluonnos Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered
4x4cup Rastikuvien tulkinta
4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,
Choose Finland-Helsinki Valitse Finland-Helsinki
Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun
LUONNOS RT 80260 EN AGREEMENT ON BUILDING WORKS 1 THE PARTIES. May 1998 1 (10)
RT 80260 EN May 1998 1 (10) AGREEMENT ON BUILDING WORKS This agreement template is based on the General Terms and Conditions of Building Contracts YSE 1998 RT 16-10660, LVI 03-10277, Ratu 417-7, KH X4-00241.
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL
Characterization of clay using x-ray and neutron scattering at the University of Helsinki and ILL Ville Liljeström, Micha Matusewicz, Kari Pirkkalainen, Jussi-Petteri Suuronen and Ritva Serimaa 13.3.2012
ETELÄESPLANADI 2 00130 HELSINKI
00130 HELSINKI MODERNIA TOIMISTOTILAA Noin VUOKRATAAN Ainutlaatuinen tilaisuus vuokrata huipputason Helsingin näköalapaikalta Toimi pian! Lisätietoja KALLE JASKARA Myyntijohtaja +358 50 324 0404 kalle.jaskara@tkoy.fi
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.8.579
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table 22.12.2014 11:33 / 1 Minimum
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Calculation: N117 x 9 x HH141 Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG
Group 2 - Dentego PTH Korvake. Peer Testing Report
Group 2 - Dentego PTH Korvake Peer Testing Report Revisions Version Date Author Description 1.0 Henrik Klinkmann First version Table of Contents Contents Revisions... 2 Table of Contents... 2 Testing...
Satelliittikuvat osana öljypäästövalvontaa
Öljypäästövalvonta Euroopan meriturvallisuusviraston (EMSA) satelliittikuvilta Kati Tahvonen Suomen ympäristökeskus Kaukokartoituspäivät 2007 Helsinki, 8.11.2007 Satelliittikuvat osana öljypäästövalvontaa
TM ETRS-TM35FIN-ETRS89 WTG
SHADOW - Main Result Assumptions for shadow calculations Maximum distance for influence Calculate only when more than 20 % of sun is covered by the blade Please look in WTG table WindPRO version 2.9.269
Expression of interest
Expression of interest Avoin hakemus tohtorikoulutettavaksi käytäntö Miksi? Dear Ms. Terhi virkki-hatakka I am writing to introduce myself as a volunteer who have the eagerness to study in your university.
EU:N ITÄMERISTRATEGIA POLITIIKKA-ALA: BIOTALOUS Maatalouden ravinteiden kierrätys. Leena Anttila Maa- ja metsätalousministeriö
EU:N ITÄMERISTRATEGIA POLITIIKKA-ALA: BIOTALOUS Maatalouden ravinteiden kierrätys Leena Anttila Maa- ja metsätalousministeriö Itämeristrategia/ PA Biotalous/ Ravinteiden kierrätys Mikä on Itämeristrategia?
Ainevirta-analyysi esimerkki Suomen typpi- ja fosforivirroista
Ainevirta-analyysi esimerkki Suomen typpi- ja fosforivirroista Materiaalivirrat ja ilmastonmuutos Teollisen ekologian seuran seminaari 28.4.2008 Riina Antikainen, Suomen ympäristökeskus Teoreettinen lähestymismalli