Kulti- Sanomat. Suomenkieliset. Kulti ry. - Kuopion yliopisto, elokuu 2000

Koko: px
Aloita esitys sivulta:

Download "Kulti- Sanomat. Suomenkieliset. Kulti ry. - Kuopion yliopisto, elokuu 2000"

Transkriptio

1 Kulti ry. - Kuopion yliopisto, elokuu 2000 Suomenkieliset Kulti- Sanomat Tässä numerossa mm: Paljastavat tutori-esittely, HP- bingo, Kalakukon syöntiohjeita, Semikavntitatiivista tutkimusta, AATU- raportti ja PJ:n palsta. Varoitus: Saattaa sisältää tarttuvaa biohuumoria!

2 Sisälmysluettelo: Kulti-sanomat Paheenjohtajan väsynyt palsta 4 Viileät tutoriesittelyt 6 Opiskelijapappa Turggusess 7 Kalakukon syöntiohje 8 Muutama haaska sana savolaesista 10 Journal of Semiquantitative Research 12 Luentobingo 13 Exothermic Hell? 14 Elämää ykkösellä! 16 Tapahtumakalenteri Julkaisee Kulti ry. Tämän numeron teossa on käytetty opiskelijoita, kieroutuneutta huumoria ja reipasta Kulti-henkeä. Kuten aina, toimitus ei vastaa mistään, ei kenellekään eikä paljasta lähteitään. Lehden aiheuttamia henkisiä kärsimyksiä ei korvata. Pääsyylliset: Rädyn Jani, BT4, Korjamon Tinippa SB4, Varjosalon Markku SB3, Team Tuskan henkinen perintö, JKR- systems ja Spirit of Kulti. (Taas kerran, huokaus.) Totuus on aina ulkona. 2

3 Pj:n palsta Taas on koittanut se aika vuodesta kun ihmiset alkavat palailemaan hiljalleen yliopistolle päin. Kesäloma/työ on takana ja nyt on aika treenata istumalihaksia luennoilla, jos siis meinaa että opintotuki kolahtaa tilille. Yliopisto täyttyy opiskelijoista fukseista ännänteen vuosikurssiin. On taas huvittavaa katsella fuksien suunnistusta ja harhailua ympäri laajaa kampustamme. Mutta älkää pelätkö fuksit, äkkiä te kotiudutte akateemiseen maailmaan ja onhan teillä oppaina tutorit (valitettavasti myös allekirjoittanut :). Teiltä fukseilta ja miksei vanhoiltakin ei vaadita muuta kuin aktiivisuutta. Opiskelu ajanhan pitäisi olla elämämme parasta aikaa. Kotiin TV:n ääreen ehdit jämähtämään keski-ikäisenäkin. Nyt on aika harrastaa kulttuuria, harrastaa liikuntaa, osallistua ainejärjestötoimintaan ja opiskelijabileisiin, viettää unohtumattomia hetkiä opiskelijatovereiden kanssa filosofisten keskustelujen parissa pikkutunneilla, saunoa vaihtooppilaiden kanssa, osallistua ylioppilaskunnan eri sektoreiden toimintaan tai vaikka perustaa oman kerhon. Tärkeintä on että teet mitä tykkäät, mutta olet partiolaisen tavoin aina valmis uusiin haasteisiin. Kaiken tekemisen ohessa täytyisi kuitenkin löytää aikaa opiskeluun, sitä vartenhan me kuulemma olemme yliopistossa kirjoilla. Välillä loputtoman tuntuisen informaatiotulvan tankkaaminen päähän voi tuntua toivottomalta urakalta, kunnes yhtäkkiä huomaatkin valmistuneesi. Paljon työtä se kuitenkin vaatii ja kriittisyyttä. Onko kaikki tämä tieto tarpeellista? Ovatko talon tavat opiskelijaystävällisiä? Onko ainejärjestön ja/tai ylioppilaskunnan toiminta puutteellista tai muuten vaan huonoa. Epäkohtiin kannattaa puuttua heti ja suoraan! Kriittisyys ja asioiden kyseenalaistaminenhan on tieteissä aivan keskeistä. Toivottavasti ehdit kaiken touhaamisesi keskellä tutustua uusiin ihmisiin ja ylläpitää yhteyttä ystäviisi, niin uusiin kuin vanhoihin. Näin lopuksi haluan toivottaa kaikille kultilaisille ja miksei muillekin tapahtumarikasta syksyä! Markku Varjosalo, PJ Those who survived the San Francisco earthquake said, Thank God, I m still alive. But, of course, those who died, their lives will never be the same again. Sen. Barbara Boxer, (D, Calif.) 3

4 Bodanneet ja leveästi eläneet kuumat tutorimme. Miika Heinonen Juulia Enbäck Pirtsakka Juulia on jo pienestä pitäen ollut oikea vesipeto, harrastuksina hänellä on ollut jo useiden vuosien ajan mm. kuviokellunta ja uppopallo. Vannoutuneena Kauniit ja Rohkeat fanina, hän on ollut jo viisi vuotta Kuopion faniosaston puheenjohtaja. Juulia tienaa sivutöinään rahaa hiusmallina olostaan L Orielilla ja hiuksistaan hänet tunnetaankin. Miika Miksuli Heinonen on vanhan suomalaisen perinnepainin, Nurmipainin vakaa harrastaja. Eelis Rytkösen jalanjälkiä seuraava Miika on hävinnyt piiriotteluistaan vain yhden. Talvikaudella Miika keskittyy toiseen harrastukseensa, kehäcurlingiin. Kuopion Curlaajiin otetaankin jatkuvasti uusia jäseniä. Vietettyään kesän töissä Primalcossa ovat Miikan harrastuksiin kuuluneet myös Tsekkoslovakialaiset viinit. Sanna Syrjäläinen Sannan akateeminen luonne juontaa jo hänen lapsuuteensa Turun tähtitornin juurelle, jossa nuori Sanna etsi pulsareita kiikareillaan. Kun pulsareita ei löytynyt, eristi viisi-vuotias Sanna ensimmäisen genominsa läheisestä ruusupusikosta. Kalliokiipeily tuo Sannan elämään jännitystä, kuten myös hänen lemmikkinään olevat kaksi bernhardilaista ja booa. Korkeasaari-kesän jälkeen Sanna menetti sydämensä lumileopardeille. Mikko Sairanen Mikko Sande Sairanen, harrastaa, kuten kaikki saunassa olivat ovat huomanneet, kehonrakennusta. Tämä tatuoitu ja lävistelty miekkonen on päässyt myös televisioon, Henry Saaren pakarastunttina! Biotekniikkaan Mikko sai kipinän, kun hänen DNA- näytteensä päätyi ensimmäisenä Turusta KRP:n arkistoihin. Monessa mukana ollut Mikko on myös Kybbo:n pj ja muutenkin mukava mies. Mutta älkää mainitko hänelle mitään hänen murteestaan! 4

5 Salla Keskitalo Salla, Turun ulkosaariston Gyltö:stä kotoisin olevana, on tottunut purjehtija, jopa mestaruustasolla. Kuopion Njep-De- Do- seuran uskollisena rahastonhoitajana toiminut Salla rentoutuu mielellään hoitamalla akvaariokalojaan ja tekemällä sushia. Sallan ura suuntaa jo vakaasti Vesigenetiikan instituuttiin Kuopion AIVI:ssa, ainakin kesätöistä päätellen. Markku Varjosalo Markku Vartsa Varjosalo, Kultin pj:näkin tunnettu, on jo pitkän linjan luontoaktiivi. Jo muinoin Talaskankaan hakkuuaukeilla köyttäytynyt Markku on Kuopion lintubongareiden KuLiBo:n aktiiveja. Vaikka nyttemmin Markku on leikannut partansa ja siistinyt hiuksensa, saattaa puheesta silloin tällöin vielä kajahtaa entistä luontohenkeä. Harva tietää, että Markku on ensimmäinen suomalainen koskinuoluvästäräkin havaitsija! Eeva Kuosmanen Tämä tyttö on lukenut ympäristötietoisena opiskelijana Ekologisen ympäristötieteen laitoksella mm. puistokemiaa ja maisemointia. Vapaa-aikanaan Eeva suunnittelee WAPprotocollia ja JaVa- ohjelmia Nokialle, vaikka hän onkin vaihtanut seksikkään IT- alan hehkuvan seksikkääseen BB- alaan. Kuopioon Eeva sopii kuin lusikka silmään, onhan hän aina halunnut olla Savolainen. You can t just let nature run wild. Wally Hickel, former governor of Alaska The Stupidist Things Ever Said By Politicians - by Ross and Kathryn Petras It isn t pollution that is hurting the environment, it s the impurities in our air and water that are doing it. -Dan Quayle It s time for the human race to enter the solar system! Dan Quayle, on the concept of a manned mission to Mars The Holocaust was an obscene period in our nation s history. I mean in this century s history. But we all lived in this century. I didn t live in this century. Senator Dan Quayle The loss of life will be irreplaceable. Vice President Dan Quayle 5

6 Opiskelijapappa Turussa vielä osaa paikallisen paperilennokkiyhdistyksen kisaan. Vielä ovat ammattilaiset kovempia, mutta tiukasti vastaan hangoitelleet kuopiolaiset lupaavat parantaa ensi vuonna. Häääähhh! Radiosta tulvii korviin Katri- Helunaa tai jotain muuta humppaa. Silmäluomet avautuvat hitaasti. Mitä ihmettä? Kellohan on vasta kuusi? Päässä takoo hieman, mutta sitten selkenee: Tänään mennään Turkuun!!! Ilme kirkastuu ja nivelet naristen kolmannen vuosikurssin opiskelija singahtaa sängystään kuin joskus muinoin fuksivuotenaan. Pienen bussimatkan jälkeen iloinen seurue saapuu Turun yliopiston virkistyspaikkaan jossain saaristossa. Opiskelijapappa hieraisee silmiään, onhan muuten upea paikka! Ilta kuluukin grillaillessa, lettuja paistaessa, jalkapalloa ja lentopalloa pelaillessa sekä tietysti ankarasti saunoessa. Yöpuulle YO-kylän kerhohuoneelle huoleton joukkio saapuu ennen kahta ja kohta kuuluu ympäriltä tasainen tuhina. Opiskelijapappakin vaipuu uneen. Pikaisen aamupalan jälkeen sankarimme on valmis iskemään mäkeä alas kimaltelevassa punaisessa haalarissaan. Rinkka selkään, arskat päähän ja menoksi. Matka koululle tuntuu yllättävän lyhyeltä toisen monet kokeneen biotieteilijän kanssa. Mutta eihän tänne nukkumaan tultu. Kahdeksan aikoihin singahdetaan enemmän tai vähemmän virkeinä ylös ja ryhdytään laittautumaan matkan pääkoitoksia varten. Myönnettävä on, ettei retkipatja kovalla lattialla vedä vertoja kaksoisjousitetulle runkopatjalle. Bussi ehti odottaa kahta sankariamme kymmenisen minuuttia ennen lopullista kytkimen nostoa. Reissun päällä alkaa tunnelma keventyä varsin pikaisesti, varsinkin ikiopiskelijoiden kansoittamalla takapenkillä. Matkan aikana pyörii kait elokuvia, mutta takaosissa eri opiskelijasukupolvet (I, II ja III vuosikurssi) keskittyvät lyömään korttia taidelasi panoksena. Yllättävän nopeasti ohitamme Posankan ja saavumme kemian laitoksen pihaan, komea pytinki muuten. Turun Amica pistää jopa Kuopion serkkuaan pahemmaksi. Onneksi pääsemme pian kokemaan historian ensimmäisen AY-juoksun huuman aivan fantastisessa säässä. Muutaman rastin ja viestin jälkeen eräät excuilijat ottavat Juvantia Pharma ja Hormos Medical esittäytyvät kalvosulkeisten muodossa. Kumma excu, kun kukaan ei näytä olevan krapulassa. Vielä pieni pyörähdys biotekniikan laitoksella, jonka jälkeen siirrymme odottamaan vesi kielellä AATUa eli Akateemista AurajokilaivuriTUtkintoa. Tällä kertaa Amica pisti paljon, paljon paremmaksi kuvun täyttämisessä. Ilma on jälleen kuin morsian. Kokeneet ketut ottavat varaslähdön ja välttävät muutaman jokilaivan ajan pahimmat jonot. Eivätkä ne loppujen lopuksi niin pahoja ole kuin miltä näyttävät. Osa suorittaa Kapteenin, osa I Perämiehen, jotkut tyytyvät Matruusin arvonimeen, muutamat nauttivat muuten vaan säästä ja seurasta. Urakan jälkeen vanhat parrat tekevät kulttuurimatkan torin Hesburgeriin. Iltabileet ovat Marilynissä, joka lienee turkulainen sekoitus Maximia ja Clonea varustettuna jättimäisellä 6

7 peilipallolla. Aamulla singahdetaan jo paljon vaisummin ylös ja osa suuntaa saunaan. Löylyä ei tosin paljoa tarvitse heittää, sillä luomet ovat yllättävän raskaat. Siivousten ja kiitosten jälkeen ostetaan aamupalaa lähikaupasta ja aloitetaan taivallus kotiin. Matka tuntuu yllättävän pitkältä, mutta onneksi uni saa välillä vallan. Ja sen kyllä huomaa niskassa. Kotona varmastikin moni miettii, että ensi vuonna uudestaan. Ja onhan meillä jo lähes amiraaliainestakin The word genius isn t applicable in football. A genius is a guy like Norman Einstein. -Joe Theisman, quarterback and sports analyst Timo Korjamo Kalakukon naatintaohje: 1. Avvoo paketti 2. Poesta kiäreet 3. Ota asseeks iso veihti ja pien huarukka 4. Paa evvääs ettees topakalle pöyvälle (ei sua täristä) 5. Hätistä muut loetommalle (voep räeskyä) 6. Iske iso veihti kärki eillä keskelle kukon selekee ja leikkoo nykyttämällä eistaas kämmenes kokone aakko 7. Nosta lämpäre kättees, paa voeta piälle ja hujjaata iäntä kohti (Se olj vasta kuorta särpimeks) 8. Huokase ja raahotu 9. Ota huarukka ja kato kukon sissään(näläkäs on jo tolokuton, etkä sisällöstä taija suaha selevee?usko poes, eissäs on herkkuva: se mössö on aetoo savolaesta pikkelssijä oekeeta ahvenkalloo kylyki kylessä toesta killoo ja joka välissä sitä ihteesä eli ison punasilimäpossun kylykee (helekutin hyvvee läskijä,tolokuttoman nuukasti lihhoo!) 10. Paa rotteesit lassii ja silimäs kii 11. Lyö huarukkas syvälle hyvvään (Jottae saet kuitennii, kaekki se on syötävän hyvvee. Piä yhä silimäs kii, mutta varo ettet tökkee nennääs.) 12. Avvoos suus ja laeta lasti maeskuttimees 13. Suus kiinni, huarukka poes 14. Elä uattele vuan naati(koeta piättee, kummasta tykkeet enemmän, kukosta vai kalasta?eläkä hättäele, usko vuan: hyvvee se olj!) 15. Anna huarukan heiluva, ruotoja ei tarvihe pelätä 16. Huokase vällii, rööhtäse ja anna himon yltyvä(voe tokkiisa!! Ja jos näläkä jäe, niin ei ku alota vuan alusta!) 7

8 MUUTAMA SANA SAVOLAISISTA Palveluja hakemassa Yleissanastoa: Yksi = Yks Kaksi = Pari Kolme = Kolome Neljä = Ee iha viittä Viisi = Viis Kuusi = Kuus Seitsemän = Seehtemän Kahdeksan = Kaheksan Yhdeksän = Yheksän Kymmenen = Jonnii verran enemmän ku yheksä Kyllä = Jo tokkiisa! Ei = Ee... Olkaa hyvä! = Olokee hyvä! / Hek! Kiitos = Kiitoksija Anteeksi = Anteeks Ei kestä = Eepä kestä En ymmärrä = Mittee? Hetkinen = Outahan hollin aekoo Anteeksi, mitä sanoitte? = Mittee työ sanoja? Hyvää huomenta = Hyvvee huomenta Hyvää päivää = Hyvvee päevee Hyvää iltaa = Hyvvee iltoo / Hyvvee illanköllykkätä Hauska tavata! = No terve vuan terve! Apua! = Aattakee! Missä on wc? = Oesko tiällä vessoo jossaen Puhutteko suomea? = Huastellaanko sitä suomee? Paljonko se maksaa? = Mittees sinä siitä pyytäsit? Voinko maksaa tä11ä luottokortilla? = Mitteepä jos vinkasutat vissoo? Voisitteko kirjoittaa sen paperille? = Pistätkö kuule tähän ylös? Saisinko postimerkin kirjeeseen? = Ee kaet tämä merkitä kule! Haluaisin vuokrata polkupyörän = Ottasin munamankelin laenaan Milloin se on valmis? Tarvitsen sen huomisaamuksi = Jokohan tuon uamulla saes? Mitä kello on? = Mittee se kello tähän aekaan näättää Onko tämä Kuopion tori? = Mahettannoonko olla Kuopijon torilla? Ostaisin lipun = Ostasin piletin Haluaisin filmin tähän kameraan = Löötyskö vilimiä kameraan? Kauanko filmin kehittäminen kestää? = Millonka on kuvat valamiina? Missä kirkko sijaitsee? = Missee piruntorjuntapunkkerj on? Autossani on vika = Aato meenoo renata Mistä täältä voi ostaa Hugo Bossin valmistamia asusteita? = Mistee tiältä suap niitä Pomo-Huukon vuatteita? Voisitteko ottaa puhelun tähän numeroon? = Pirraatatko tähän numeroon? 8

9 Missä on lähin alkoholiliike? = Ossootko neovoo paekallisseen pitkäripaseen? Saanko oluen! = Toesijako kaljan! Saisinko paikallista olutta? = Oesko jottae tämänseuvun kaljoo? Kohteliaita sanontoja eri tilanteisiin Kulti-sanomat 2000 Pääsisinkö tästä ohitse? = Väestähän vähäsen Olen pahoillani, en polta = Osta vuan omat tupakkis Tarkoitukseni ei ollut loukata neitiä = Oo tässä akkoen mieliks! Ei, en sanonut teistä mitään = Mittees siinä toljotat? En toki haastaisi riitaa noin ison miehen kanssa = Outtele siinä, nunä kutun poejat! Anteeksi, ei ollut tarkoitus töniä = Mäne muuvalle siitä torottammaan! Olen pahoillani = Häh, mikä se Anteeksi häiriö = Kuulettako työ! Assistentti, minulla on väärä näyte!= Äejä, tämä aene o aevan tolokuttoma hajusta ja suattaapi olla, etteioo aevan ehtoo itteesäkään. Olet viehättävän näköinen neitokainen! = Sinnout läsäkän näkönen pimu! Menkää tiehenne! = Alakakee kalappia! Mitä tämä tarkoittaa? = Mittees se tämä meinoo? Taidan siirtyä inkuboimaan= Taijanpa lähtevä ottamaan nokoset Kultin kansikuvapojat kuumassa fanikuvassa! Kerää koko linssilude- sarja! 9

10 Journal of Semiquantitative Research: GM- vesi Olemme saanet luvan julkaista myös täällä Kulti-sanomissa maailmassa ja Kirgiisiassa suurta kohua herättäneen uraa-uurtavan tutkimuksen vesigenetiikan alalta. Tutkimuksen tekijöinä kaksi nuorta ja salskeaa huippututkijaa. Tutkimus oli valtavirrasta poiketen suoritettu tutkijoiden omalla henkilökohtaisella riskirahoituksella. (Soveltavan biotekniikan instituutti lahjoitti tutkijoille 50 litraa geenimuuntelematonta vettä) Fil. yo, cl- kemisti T. Korjamo tiivistää tutkimuksen tavoitteet seuraavasti: -Pienentää veden painoa nykyisestä 1000 grammasta 870,3 grammaan litralta kuljetuskustannusten säästämiseksi. Arvioimme tästä koituvat säästöjen maailman kansantaloudelle ylittävän 18,32 prosenttia. - Lisätä veden kosteutta tuntuvasti entiseen verrattuna. Tämän modifikaation vaikutukset tulevat olemaan tuntuvat maataloudelle ja agrikulturaaliselle elämäntavalle sellaisena kuin me sen tunnemme (mm. kosteusvoiteiden tarpeen väheneminen, huonekasvien kastelutarpeen väheneminen ja veden kosteuden puutteen väheneminen kuivilla alueilla.) - Veden pakkaskestävyyden parantaminen geenisiirroilla. Pakkaskestävämpi vesi parantaa Suomen kansantalouden tilaa arviolta noin 34,3 %. - Perustaa oma Sovelletun vesigenetiikan instituutti ja aloittaa uusien opiskelijoiden sisäänotto välittömästi. - Siirtää Helsingin kaupungin vesilaitos Kuopioon. Menetelmissään nuoret tutkijat hyödynsivät tutkimuksessaan vielä prototyyppiasteella olevia seuraavan sukupuolen geeninsiirtomenetelmiä. Menetelmät pohjautuivat vahvasti semikvantitatiiviseen ajatteluun ja kokeneiden tutkijoiden vankkaan ammattitaitoon. LuK, cl- kemisti J. Räty luettelee käytetyt menetelmät: - S. Cerevisiae- välitteinen geneettisen informaation stabiili ja instantti transfektio. - Etanoli-välitteinen kromosomiston gradienttimodifikaatio. - Zeta-aalto välitteinen sähkömagneettisen säteilyn disruptioon ja interferenssiin perustuva pistemutaatio. Vasemmalla tutkijoiden S.cerevisisae- välitteinen geeninsiirto käynnistymässä. Menetelmä: YTV:hen mitattiin 1,37 ml lähtömateriaalia ( Kontaminaatiovapaata vettä ) ja seuraavaksi tutkija valmistautui lisäämään kuivatun S. cerevisae ( Sunnuntai ) gluteus maximustuntemuksella. Lisättyään S. cerevisae:n, YTV:hen, aloitettiin nopea mutta kankea pyöritys vastapäivään ( Pohjoinen pallonpuolisko ). Tämän jälkeen näytteen tiheys määritettiin vaa alla ja pakkaskestävyyttä testattiin Rosenlew Vähävirtanenjäädytyskaappilaitteistolla 20 C:ssa. Geenisiirron stabiloimiseksi YTV:n välittömässä läheisyydessä (45,34 % ± 0,4 ) tuli olla pullollinen Virkonstabilanttia. Tutkija fil.yo, cl- kemisti T. Korjamo kertoo hieman uudesta etanolivälitteisestä kromosomiston gradienttimodifikaatiosta: Tämä geeninsiirtotekniikka ei ole maailmalla toistaiseksi kovinkaan laajalti tunnettu 1, mutta Suomessa ollaan jo pitkällä sen soveltamisessa. Ethanol transform vehicle ( Schott Duran, keskihylly ), myöh. ETV, toimi tässä menetelmässä stabiilina matriksina, joka vähensi 73 % kontaktia ulkomaailman transferenssia vastaan. Tutkija, LuK, cl-kemisti J. Räty lisää että, ETV:n amorfinen ja semistabiili pinta torjui myös 32,4 % haitallisia UV-B säteitä, jotka olisivat voineet aiheuttaa lisää haitallisia mutaatioita. 10

11 Tutkimus aloitettiin pipetoimalla (Biohit) 1 ml vierasgeenivapaata vettä ja lisäämällä vektorina (Veksna) toimivaa etanolia (EtOH- B) 2 ml ETV:hen. Seuraavaksi ETV:lle annettiin lämpöshokki haudutusteholla 100 W/ 1 min (Upo 1310 Tasalämpö- mikro sisältäen rotating- ominaisuuden), jonka jälkeen punnitsimme ETV:n vaa alla Kosteusmittaukset teimme Ultrospec sofistikoituneella mittauslaitteistolla, määrittäen DNA: pitoisuuden, joka korreloi suoraan ns. Moisture-ominaisuuksien kanssa 1.Pakkaskestävyysominaisuudet mittasimme Rosenlew Vähävirtanen- jäädytyskaappilaitteistolla 20 C:ssa. Yhteen ääneen, silminnähden innostuneet tutkijat huutavat kilpaa seuraavat lauseet : Uutena mullistavana menetelmänä meillä oli Zeta-aalto välitteinen sähkömagneettisen säteilyn disruptioon ja interferenssiin perustuva pistemutaatio, joka ei ole maailmalla toistaiseksi kovinkaan laajalti tunnettu 1, mutta Kuopiossa (Neulamäki) ollaan jo pitkällä sen soveltamisessa. Zetawave transform vehicle ( Schott Duran, alahylly ), myöh. ZTV, toimi tässä menetelmässä stabiilina matriksina, joka vähensi 71 % kontaktia ulkomaailman transferenssia vastaan. Sen amorfinen ja semistabiili pinta torjui myös 30,2 % haitallisia UV-B säteitä, jotka olisivat voineet aiheuttaa uusia haitallisia mutaatioita. Tutkija varustautui Zeta-aaltos Vahvistautasvehjasä : lla (Biohit, Lithuania) ja aloitti pistemutaatioiden luomisen veteen. Kohteenamme oli sekvenssin ATGC T:n muuttaminen A:ksi. Sivutuotteena saattoi syntyä tosin G- C tai A- T mutaatioita ja sekvenssin ATTCGGTGGGTGGGTATCGC muuttumista ATTCGCCGGCGATTAGCGCA:ksi (p= 0,0564 ja t>46,44 ± mittaustarkkuus. Tutkija keskittyi ja vapautti sisäisen Zeta-aaltonsa. Tässä tutkijaa auttoi suuresti zeta-aaltojen fyysinen ja transsendenttinen materialisoituma 2. Aaltojen seurauksena veden nukleotidiketjun difosfoesteri- backbonessa tapahtui em. haluttuja mutaatioita. Näiden muutosten seurauksena saimme aikaan fysikaalisia muutoksia. Myös tutkijoiden pankkitilillä tapahtui odottamattomia muutoksia. Molemmat tutkijat hehkuttavat tuloksia innoissaan: Tämänkin tutkimusraportin laadinnan aikana Helsingin kaupungin vesijohtolaitos eteni 2 µm Kuopiota kohden ja Sovelletun Vesigenetiikan Laitoksen perustamistoimenpiteiden jouduttamiseksi olemme panneet vireille Biokemian laitoksen kahtiajaon. Tuloksia tarkastellessa voidaan selvästi huomata vesigeneettisten modifikaatioiden positiivinen vaikutus tutkijoiden talouteen (36,22 %, julkaisematonta dataa, Merita oyj ja Osuuspankki). Lisäksi voidaan huomata selkeästi EGTmenetelmän edut muihin menetelmiin verrattuna. Etanolivälitteisessä geeninsiirrossa saavutimme selkeästi halutut tavoitteemme, veden tiheyden pieneneminen (14 %± mittaustarkkuuden neliö), pakkaskestävyyden lisääntyminen 16 C :seen, kosteuden lisääntyminen huomattavasti. Arvioimme tuoreissa laskelmissamme geenimanipuloitujen vesimolekyylien vaikutusta kansantalouteen ja saimme tuloksiksi 16,4 %. Tämä ei ole lainkaan niin hyvä kuin ryhmämme aluksi arvioima 32,4 %. Tämä luultavasti johtuu muiden menetelmien huonosta toimivuudesta. Myös piin arvon kausivaihtelut Helsingin pörssin HEX- indeksissä saattavat aiheuttaa globaalia kalkylointimatriksin fluktuaatiota. Varsinkin Zeta-aaltovälitteinen menetelmä osoittautui toisen ryhmän lupaavista tuloksista 1 huolimatta eräänlaiseksi tieteelliseksi ankaksi (vrt. kylmäfuusio). Kuitenkin uskomme vahvasti tulevaisuuden tuovan mukanaan myös tämänkin alan kehitystä. Suomen tiedepolitiikan olisi jo aika panostaa tieteellisten ankkojen tarhaukseen, jalostukseen ja kasvatukseen, jotta Suomen geopoliittinen kilpailukyky säilyisi kansainvälisessä kilpailussa. Hiivamenetelmä kohdisti DNA-modifikaationsa vääriin operoneihin. Onnistuimme lisäämään geneettisesti huomattavasti veden sameutta ja tunkkaista hajua. Näin kylmän sodan päätyttyä emme kuitenkaan usko kyseisillä ominaisuuksilla olevan merkitystä edes entisille Varsovan liiton jäsenmaille. Tahdomme esittää kiitoksemme kaikille meitä taloudellisesti (ei ketään) ja henkisesti (eräs alan professori Atte von) tukeneille. Hänen lohdulliset sanansa: Vesi on hyvää vain veneen alla loivat meihin uskoa tutkimuksemme synkimpinä hetkinä. (Tutkimus on-line: Lähteet: 1.Aproksimanoff KS ja Spekulatoff YK, Genetics and complete cdna- sequence of tapwater, The North-East Kirgiisian Journal of Applied Science for Illiterate Peasants, 49(1) 2-30, Catherine Zeta-Jones 3. Internet 11

12 Hevonpaskabingo Hevonpaskabingo Tässä ajankulua kemian luennoille. Peli toimii perinteisen bingon tapaan: Seuraa tarkasti luennoitsijan puheita. Hänen päästäessään ilmoille jonkin ruudukossa olevan sanan tai asian, ruksi kyseinen ruutu viereisestä taulukosta. Erikoisruudun Mauri saat rastittaa, kun näet Maurin. Saadessasi vaaka-, pysty- tai vinoriville 5 rastia, huuda kuuluvalla äänellä: Hevonpaskaa!!! Tällöin olet onnellinen voittaja. 12

13 The following is an actual question given on a University of Washington chemistry mid term. The answer was so profound that the professor shared it with colleagues, which is why we now have the pleasure of enjoying it as well. Bonus Question: Is Hell exothermic (gives off heat) or endothermic (absorbs heat)? Most of the students wrote proofs of their beliefs using Boyle s Law, (gas cools off when it expands and heats up when it is compressed) or some variant. One student, however, wrote the following: First, we need to know how the mass of Hell is changing in time. So we need to know the rate that souls are moving into Hell and the rate they are leaving. I think that we can safely assume that once a soul gets to Hell, it will not leave. Therefore, no souls are leaving. As for how many souls are entering Hell, lets look at the different religions that exist in the world today. Some of these religions state that if you are not a member of their religion, you will go to Hell. Since there are more than one of these religions and since people do not belong to more than one religion, we can project that all souls go to Hell. With birth and death rates as they are, we can expect the number of souls in Hell to increase exponentially. Now, we look at the rate of change of the volume in Hell because Boyle s Law states that in order for the temperature and pressure in Hell to stay the same, the volume of Hell has to expand as souls are added. This gives two possibilities: 1. If Hell is expanding at a slower rate than the rate at which souls enter Hell, then the temperature and pressure in Hell will increase until all Hell breaks loose. 2. Of course, if Hell is expanding at a rate faster than the increase of souls in Hell, then the temperature and pressure will drop until Hell freezes over. So which is it? If we accept the postulate given to me by Ms. Teresa Banyan during my Freshman year,...that it will be a cold day in Hell before I sleep with you., and take into account the fact that I still have not succeeded in having sexual relations with her, then, #2 cannot be true, and thus I am sure that Hell is exothermic and will not freeze. The student received the only A given. 13

14 MITÄ FUKSIVUODESTA JÄI MIELEEN? Päällimmäiseksi muistoksi ensimmäisestä päivästä ihka oikeana yliopisto-opiskelijana jäi kihelmöivä jännityksen tunne. Olo oli samaan aikaan innokas ja epävarma ja päässä risteili paitsi mielikuvia riehakkaasta opiskelijaelämästä myös kymmeniä epätietoisia ajatuksia tulevasta vuodesta..voisiko tänne ennalta tuntemattomaan savolaiskaupunkiin kotiutua?...entäpä opiskelun aloittamiseen liittyvät käytännön seikat?..ovatko uudet opiskelukaverit ihan mukiinmenevää porukkaa..?! Onneksi kyvykkäät tutorimme kaappasivat meidät tulokkaat siipiensä suojiin heti alkumetreillä. Tutorien vanavedessä kolusimme yliopiston kampusta Savilahden molemmin puolin ja selvitimme reitin omalle laitokselle.meitä keltanokkia perehdytettiin kärsivällisyydellä myös kirjaston toimintaan ja opastettiin tulkkaamaan lukujärjestyksen selittämättömiä kirjainlyhenteitä.luokkatilojen ja luentosalien koodien yhteys niiden sijaintiin jäi kyllä allekirjoittaneille ikuisiksi ajoiksi epäselväksi, mutta KYY-kalenterin kartan avulla selvittiiin!!pitkälle syksyyn jatkuneiden tutorkokoontumisten myötä meille aukenivat monet akateemiseen aherrukseen liittyvät mysteerit, kuten Tiukkisbileiden syvin olemus ja muut Kultina olemisen hienoudet. Kuin huomaamatta ropsahtivat ensimmäiset opintoviikot tilille ja puuhailu koeputkiloitten ja pipettien kanssa labran nurkissa marraskuun iltoina tuntui melkein luontevalta.kevätpuolellä harjaannuimme milteinpä mestareiksi mikroskoopin käytössä ja perehdyimme ihmisen anatomiaan.kemia puolella oli luvassa orgaaninen osuus, overlappaus ja karbokationin toisiintuminen olivat ainakin hetkellisesti hallussa..kuopio kalakukkoineen alkoi tuntua ihan mukavalta kaupungilta ja solukämppäänkin sopeutui hetkellisistä henkilökemioiden törmäilyistä huolimatta. Ehdottomia kohokohtia tapahtumarikkaan fuksivuoden varrelta olivat tietysti Akateeminen startti syyskuun piristyksenä sekä Puijon rinteiden 24 TL-lumileikit kevättalvella. Ei pidä myöskään unohtaa millilitrojen saalistuksen loppuhuipennusta eli ainejärjestön pikkujouluja..tai Turun excua..tai kemianpäiviä..tai sitä virallista hetkeä, kun puki uunituoreen Kultihaalaarin ekaa kertaa päälleen. Vuoden aikana tuli siis tehtyä muutakin kui eksyttyä luennolle väärään saliin tai piipahdettua uusimassa tenttiä.eräät löysivät itsensä jopa uuden hallituksen kokouksista kahvia hörppimästä!ja tulevaa lukukautta varten on taas monta jekkua takataskussa.. Juulia & Terhi I ve read about foreign policy and studied, I now know the number of continents. -George Wallace, 1968 presidential campaign 14

15 Savolainen työohje Ku savolaene avvoo pettuluukkusa, vastuu ottaa ja siirtyvä lujahuttaa kuulijoelle Kah, uot selevinnä tänne suakka. Varroohan käsilles las'tekka ja roeskase siihen kunnon tujjaas ehtoo höselii. Tae suat olla roeskasemattakii Vuan kun uot sen tehnynnä, lurraata semmonen napakka kurraas tiukkoo honnoo ja hullaata sekkaan jonkinmoenen kasa sinkkijä.eti melekosen sutjakkaasti jokkii riski möliskö, ja pyyvähän inehmoo nuuskasemmaan. Ja, vot, va jos ee kuulu mölisköstä kohtiisa halavatun äkinnäestä parkunnaa, niin suattaapa olla ettee oo aevan niin onnistunna tuo homma ku oel tarkotus. Va jos lähtöö mölisköstä ätäkät iänet, niin hilipaseha vähä kaavemmas, suattaa olla äkänen kuha tokenoo Rohvessorijen kaahuks toenennii kyhhääs No, va sittä pittää hommata esille par sattoo millijä tae enemmännii, jos vaaraasta torpasta uot lähtennä, tolujeeniä, tarpeeks mankeesiumia ja piälle veetöntä eetterijä ja laetahan ne issoon pulloon, jossa on jotikije. Laeta uuninpankolle porisemmaa pariks tuntija ja kää keettämässä tujakat kahveet. Va jos vielä kehtoot, tulehan takasi ja kää laskemassa siitä harmoosta pullosta, jossa o semmonen ulukomuanhuasteella präntätty varotus, kah niin, siitä otat hiilitijoksiitia kiinteenä ja kurraatat keitokset siihen. Lissee paljo naohija ja pyyvä sitä möliskötä, jos tuo vielä huasteloo kanssas, sekottelemmaa. Anna sekotella aekasa ja hörppee raahassa sumppija. Sitte uuttele veellä muutamisen kerran. Kah, sitte vuan suatat piälle höselii ja kahtelet ku sakkoo. Otaha taltee sakat, ja ruapase vähä puhtaammaks. Va, suattaapa sitte olla että oot suanunna aekaan pentseenihappova, va eepähän sitä tiijä, vaekka sieltä oes tullunna jottae muutakkii. Eepähää oo kukkaa vielä savolaesen huasteluilla mittää oppinna, va eepähä oo tyhmentynykkää Did you know? The short-term memory capacity for most people is between five and nine items or digits. This is one reason that phone numbers were kept to seven digits (not including area code). Synesthesia is a rare condition in which the senses are combined. Synesthetes see words, taste colors and shapes, and feel flavors. The simple act of walking requires the use of 200 muscles in the human body. 40 or so will lift your leg and move it forward. The African bushman lives in a quiet, remote environment and has no measurable hearing loss at age 60. The size of your foot is approximately the size of your forearm. The average adult has between 40 and 50 billion fat cells. The average adult stands 0.4 inch (1 cm) taller in the morning than in the evening, because the cartilage in the spine compresses during the day. The skeleton of an average 160 pound body weighs about 29 pounds. The soft mass of the adult brain is motionless. Though it consumes up to 25 percent of the blood s oxygen supply, it does not grow, divide, or contract. The sound of a snore (up to 69 decibels) can be almost as loud as the noise of a pneumatic drill (70 90 decibels). The strongest bone in the body, the thigh bone, is hollow. Ounce for ounce, it has a greater pressure tolerance and bearing strength than a rod of equivalent size in cast steel. The strongest muscle in the body is the tongue. The substance that human blood resembles most closely in terms of chemical composition in sea water. The swine flu vaccine in 1976 caused more death and illness than the disease it was intended to prevent. 15

16 TAPAHTUMAKALENTERI SYKSY 2000 Kulti-sanomat 2000 ELOKUU Fuksit aloittavat opintonsa Kultin tervetuliaisilta Tiukanlinnassa, OPM Kaupunkisuunnistus ja jatkot Ravintola Tähdessä SYYSKUU 5.9. Syksyn 2000 ensimmäiset yo-päivät Lukemalla 6.9. Kauppakadun korkkajaiset, järjestäjänä PSAKO 7.9. Yliopiston avajaiset klo Pooli varannut Tiukkiksen kastajaisiin Hyeenan kastajaiset; Tiukkis Hyvät Kuvat Sociuksen kastajaiset Tiukkiksessa Hyvät Kuvat AKATEEMINEN STARTTI!! Hyvät Kuvat LOKAKUU Hyeenan kostajaiset Tiukkiksessa Opiskelijalähetyksen tapahtuma Tiukkiksessa Yo-päivät Lukemalla Hyvät kuvat Hyvät kuvat Sociuksen vuosijuhla Tiukkiksessa Hyvät Kuvat MARRASKUU Hyvät kuvat Fortiksen vuosijuhlien jatkot Tiukkis Yo-päivät Lukemalla Hyvät kuvat Hyvät kuvat Kemian päivät 2000, syysexcu. Haalarit tähän mennessä! Ylioppilaskunnan vuosijuhla Hyvät kuvat Hyvät kuvat JOULUKUU FO-Kuopion vuosijuhlat Yo-päivät Lukemalla Itsenäisyyspäivän soihtukulkue Hyvät kuvat Kultin ja Kybbon pikkujoulut, kauden palkinnot Kultin joulumyyjäiset Muista myös: Kemistiliitto-info, Kybbo-saunailta, Kultin yleiskokous. Nyt Kultin jäsenille Puijonkadun Instrumentariumissa sandaalialennus! Kulti ry:n jäsenkortilla saa % alennnusta sandaaleista. Kultin jäsenyys siis kannattaa! Onhan sinulla jo jäsenkortti?

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi

Lisätiedot

Choose Finland-Helsinki Valitse Finland-Helsinki

Choose Finland-Helsinki Valitse Finland-Helsinki Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun

Lisätiedot

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project

Lisätiedot

You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed

You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed Online Meeting Guest Online Meeting for Guest Participant Lync Attendee Installation Online kokous vierailevalle osallistujalle Lync Attendee Asennus www.ruukki.com Overview Before you can join to Ruukki

Lisätiedot

Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa. Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio

Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa. Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio Päättääkö opettaja ohjelmasta? Vai voisivatko opiskelijat itse suunnitella

Lisätiedot

Contents. Kuinka monta jakson sanaa opit? Väritä tähdet. Hello. Numbers. Colours. 1. This is me. 2. Clothes. 3. Family. 4. Home. 5. Food. 6.

Contents. Kuinka monta jakson sanaa opit? Väritä tähdet. Hello. Numbers. Colours. 1. This is me. 2. Clothes. 3. Family. 4. Home. 5. Food. 6. Contents Kuinka monta jakson sanaa opit? Väritä tähdet. Hello Numbers Colours 1. This is me 2. Clothes 3. Family 4. Home 5. Food 6. I can 7. School 8. Hobbies 9. Animals 10. Moving around EXTRA Hello Piirrä

Lisätiedot

Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa:

Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa: Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa: Koulutukseen ja Te-toimiston rooliin liittyviä kysymykset: 1. Olen yli 30-vuotias mutta

Lisätiedot

SELL Student Games kansainvälinen opiskelijaurheilutapahtuma

SELL Student Games kansainvälinen opiskelijaurheilutapahtuma SELL Student Games kansainvälinen opiskelijaurheilutapahtuma Painonnosto 13.5.2016 (kansallinen, CUP) Below in English Paikka: Nääshalli Näsijärvenkatu 8 33210 Tampere Alustava aikataulu: Punnitus 12:00-13:00

Lisätiedot

Objektiharjoituksia. Harjoitus 2 Tässä on lyhyitä dialogeja. Pane objektit oikeaan muotoon. 1) - Vien... TÄMÄ KIRJE postiin.

Objektiharjoituksia. Harjoitus 2 Tässä on lyhyitä dialogeja. Pane objektit oikeaan muotoon. 1) - Vien... TÄMÄ KIRJE postiin. Objektiharjoituksia Harjoitus 1 Pane objekti oikeaan muotoon. 1. Ensin te kirjoitatte... TÄMÄ TESTI ja sitten annatte... PAPERI minulle. 2. Haluan... KUPPI - KAHVI. 3. Ostan... TUO MUSTA KENKÄ (mon.).

Lisätiedot

Laskennallisen fysiikan esimerkkejä avoimesta tutkimuksesta Esa Räsänen Fysiikan laitos, Tampereen teknillinen yliopisto

Laskennallisen fysiikan esimerkkejä avoimesta tutkimuksesta Esa Räsänen Fysiikan laitos, Tampereen teknillinen yliopisto Laskennallisen fysiikan esimerkkejä avoimesta tutkimuksesta Esa Räsänen Fysiikan laitos, Tampereen teknillinen yliopisto Julian Voss, Quantum man, 2006 (City of Moses Lake, Washington, USA) Kolme näkökulmaa

Lisätiedot

Lukio.fi. Laura Simik Pääsihteeri Suomen Lukiolaisten Liitto

Lukio.fi. Laura Simik Pääsihteeri Suomen Lukiolaisten Liitto Lukio.fi Laura Simik Pääsihteeri Suomen Lukiolaisten Liitto Liikkeelle lähtö Ajatus1 Tavaa o n g e l m a Lukio.fi = commodore64 Sivusto yhtä aikansa elänyt ja viihdyttävä kuin otsapermis tai NKOTB Julkaisujärjestelmä

Lisätiedot

ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana

ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä

Lisätiedot

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research

Lisätiedot

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti

Lisätiedot

Junaelokuva 6 (kuvausversio) 14.8.2011. Kirjoittanut: Ismo Kiesiläinen. sekä Leena Kuusisto. Alkuperäisidea: Julieta Lehto

Junaelokuva 6 (kuvausversio) 14.8.2011. Kirjoittanut: Ismo Kiesiläinen. sekä Leena Kuusisto. Alkuperäisidea: Julieta Lehto Junaelokuva 6 (kuvausversio) 14.8.2011 Kirjoittanut: Ismo Kiesiläinen sekä Leena Kuusisto Alkuperäisidea: Julieta Lehto 01 INT. RAVINTOLAVAUNU - ALKUILTA Tyttö istuu junan ravintolavaunussa pienen baaripöydän

Lisätiedot

Alueellinen yhteistoiminta

Alueellinen yhteistoiminta Alueellinen yhteistoiminta Kokemuksia alueellisesta toiminnasta Tavoitteet ja hyödyt Perusterveydenhuollon yksikön näkökulmasta Matti Rekiaro Ylilääkäri Perusterveydenhuollon ja terveyden edistämisen yksikkö

Lisätiedot

Kielenkäytön näkökulma oppimisvuorovaikutukseen

Kielenkäytön näkökulma oppimisvuorovaikutukseen Kielenkäytön näkökulma oppimisvuorovaikutukseen Tarja Nikula Soveltavan kielentutkimuksen keskus tarja.nikula@jyu.fi Kiinnostuksen kohteena Luokkahuonevuorovaikutus vieraalla kielellä englannin kielen

Lisätiedot

Katsaus museoiden kokoelmahallintajärjestelmiin

Katsaus museoiden kokoelmahallintajärjestelmiin Katsaus museoiden kokoelmahallintajärjestelmiin Tiedonhallintakeskus Vesa Hongisto 11.2.2009 In his book Smart Selection and Management of Association Computer Systems, Thomas J. Orlowski states: Think

Lisätiedot

Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ

Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ Biojätteen keruu QuattroSelect - monilokerojärjestelmällä 21.10.2015 Tiila Korhonen SUEZ Agenda 1 SITA Suomi on SUEZ 2 QS, mikä se on? 3 QS maailmalla 4 QS Suomessa 5 QS Vaasassa SITA Suomi Oy ja kaikki

Lisätiedot

Ohjelmointikielet ja -paradigmat 5op. Markus Norrena

Ohjelmointikielet ja -paradigmat 5op. Markus Norrena Ohjelmointikielet ja -paradigmat 5op Markus Norrena Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Huom!

Lisätiedot

HELBUS CONDUCT. Welcome to HELBUS. We are happy you are here!

HELBUS CONDUCT. Welcome to HELBUS. We are happy you are here! HELBUS CONDUCT Welcome to HELBUS. We are happy you are here! Our mission is to offer young people a path to a career in international business. Let us be your steppingstone for global opportunities! Explore

Lisätiedot

Vallataan varainhankinta. Salla Saarinen 24.2.2014

Vallataan varainhankinta. Salla Saarinen 24.2.2014 Vallataan varainhankinta Salla Saarinen 24.2.2014 1 Salla Saarinen Varainhankinnan Kampanjoinnin Markkinoinnin Sparrausta * Koulutusta * Suunnittelua * Toteutusta Lisää tunnetta ja tulosta järjestökentälle

Lisätiedot

Twinning 2011 the real story UNCUTVERSION

Twinning 2011 the real story UNCUTVERSION Twinning 2011 the real story UNCUTVERSION 18. elokuuta kello 14.30 Hki- Vantaan kentällä alkoi tämän vuotinen Twinning vierailumme kaksoiskamariimme Stadeen. Lento lähti 17.30, mutta puheenjohtajamme Jarno

Lisätiedot

Täytyy-lause. Minun täytyy lukea kirja.

Täytyy-lause. Minun täytyy lukea kirja. Täytyy-lause Minun täytyy lukea kirja. Kenen? (-N) TÄYTYY / EI TARVITSE perusmuoto missä? mistä? mihin? milloin? miten? millä? Minun täytyy olla luokassa. Pojan täytyy tulla kotiin aikaisin. Heidän täytyy

Lisätiedot

ENE-C2001 Käytännön energiatekniikkaa. Aloitustapaaminen 11.4.2016. Osa II: Projekti- ja tiimityö

ENE-C2001 Käytännön energiatekniikkaa. Aloitustapaaminen 11.4.2016. Osa II: Projekti- ja tiimityö ENE-C2001 Käytännön energiatekniikkaa Aloitustapaaminen 11.4.2016 Osa II: Projekti- ja tiimityö Sisältö Projektityö Mitä on projektityö? Projektityön tekeminen: ositus, aikatauluhallinta, päätöksenteon

Lisätiedot

Guidebook for Multicultural TUT Users

Guidebook for Multicultural TUT Users 1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen

Lisätiedot

ALOITUSKESKUSTELU / FIRST CONVERSATION

ALOITUSKESKUSTELU / FIRST CONVERSATION ALOITUSKESKUSTELU / FIRST CONVERSATION Lapsen nimi / Name of the child Lapsen ikä / Age of the child yrs months HYVINKÄÄN KAUPUNKI Varhaiskasvatuspalvelut Lapsen päivähoito daycare center / esiopetusyksikkö

Lisätiedot

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa?

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Kerro meille datastasi työpaja 10.4.2013 Antti Auer Tietohallintopäällikkö Jyväskylän yliopisto Strateginen kehittäminen Johtamista, tutkimushallintoa

Lisätiedot

LYTH-CONS CONSISTENCY TRANSMITTER

LYTH-CONS CONSISTENCY TRANSMITTER LYTH-CONS CONSISTENCY TRANSMITTER LYTH-INSTRUMENT OY has generate new consistency transmitter with blade-system to meet high technical requirements in Pulp&Paper industries. Insurmountable advantages are

Lisätiedot

AJANILMAISUT AJAN ILMAISUT KOULUTUSKESKUS SALPAUS MODUULI 3

AJANILMAISUT AJAN ILMAISUT KOULUTUSKESKUS SALPAUS MODUULI 3 AJAN ILMAISUT AJAN ILMAISUT 1. PÄIVÄ, VIIKONPÄIVÄ 2. VUOROKAUDENAIKA 3. VIIKKO 4. KUUKAUSI 5. VUOSI 6. VUOSIKYMMEN, VUOSISATA, VUOSITUHAT 7. VUODENAIKA 8. JUHLAPÄIVÄT MILLOIN? 1. 2. 3. 4. maanantai, tiistai,

Lisätiedot

Kestävä kehitys - Lupa toimia eri tavalla. 2013 20.9. Naantali Anssi Tuulenmäki, Yli-innovaatioaktivisti

Kestävä kehitys - Lupa toimia eri tavalla. 2013 20.9. Naantali Anssi Tuulenmäki, Yli-innovaatioaktivisti Kestävä kehitys - Lupa toimia eri tavalla 2013 20.9. Naantali Anssi Tuulenmäki, Yli-innovaatioaktivisti Tutkimuspäällikkö vai Yli-innovaatioaktivisti? Vastaanottovirkailija vai First Impression Manager?

Lisätiedot

MOOC toiveita ja pelkoja. Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto

MOOC toiveita ja pelkoja. Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto MOOC toiveita ja pelkoja Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto Messukeskus 2.12.2013 massive open online course 1980 jokaisella on pilvi taskussa 1869 2013 Aika

Lisätiedot

The role of 3dr sector in rural -community based- tourism - potentials, challenges

The role of 3dr sector in rural -community based- tourism - potentials, challenges The role of 3dr sector in rural -community based- tourism - potentials, challenges Lappeenranta, 5th September 2014 Contents of the presentation 1. SEPRA what is it and why does it exist? 2. Experiences

Lisätiedot

3. kappale (kolmas kappale) AI KA

3. kappale (kolmas kappale) AI KA 3. kappale (kolmas kappale) AI KA 3.1. Kellonajat: Mitä kello on? Kello on yksi. Kello on tasan yksi. Kello on kaksikymmentä minuuttia vaille kaksi. Kello on kymmenen minuuttia yli yksi. Kello on kymmenen

Lisätiedot

UX NÄKÖKULMA - KONECRANES

UX NÄKÖKULMA - KONECRANES UX NÄKÖKULMA - KONECRANES Johannes Tarkiainen Industrial Design Manager KONECRANES NUMEROINA LAITTEET TOIMINTOJA LÄHES 60 % 11 800 TYÖNTEKIJÄÄ 600 TOIMIPISTETTÄ ERI PUOLILLA MAAILMAA 50 MAASSA LIIKEVAIHDOSTA

Lisätiedot

Digitalisoituminen, verkottuminen ja koulutuksen tulevaisuus. Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu

Digitalisoituminen, verkottuminen ja koulutuksen tulevaisuus. Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu Digitalisoituminen, verkottuminen ja koulutuksen tulevaisuus Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu The future is already here - it is just unevenly distributed.

Lisätiedot

Uni ja lepo töissä sallittua vai kiellettyä?

Uni ja lepo töissä sallittua vai kiellettyä? Uni ja lepo töissä sallittua vai kiellettyä? 21.8.2014 Professori, KTT, Anu Valtonen Lapin yliopisto, Yhteiskuntatieteiden tiedekunta Tausta Tutkimusprojekti New Sleep Order Mitä on tapahtumassa unen ja

Lisätiedot

Millainen on onnistunut ICT-projekti?

Millainen on onnistunut ICT-projekti? Millainen on onnistunut ICT-projekti? Ohjelmistotuotannon lehtori Tero Tensu Ahtee Ohjelmistotekniikan laitoksella 1990- Projektityö-kurssilla 1991- pesunkestävä yliopistohampuusi ei päivääkään oikeissa

Lisätiedot

Aakkoset Aa Ii Uu Ss Nn Ee Oo Ll Rr Mm Tt Ää Pp Kk Jj Vv Hh Yy Öö Dd Gg Bb Ff Cc Ww Xx Zz Qq Åå Numerot 0 1 2 3 4 5 6 7 8 9 10 Kuka on...? (adjektiivit) 1. 2. 3. 4. 5. 6. 7. 8. Kenellä on...? (omistaminen)

Lisätiedot

4x4cup Rastikuvien tulkinta

4x4cup Rastikuvien tulkinta 4x4cup Rastikuvien tulkinta 4x4cup Control point picture guidelines Päivitetty kauden 2010 sääntöihin Updated for 2010 rules Säännöt rastikuvista Kilpailijoiden tulee kiinnittää erityistä huomiota siihen,

Lisätiedot

Inessiivi, elatiivi, illativi, adessiivi, ablatiivi vai allatiivi?

Inessiivi, elatiivi, illativi, adessiivi, ablatiivi vai allatiivi? KERTAUSTEHTÄVIÄ WS 05/06 A Inessiivi, elatiivi, illativi, adessiivi, ablatiivi vai allatiivi? 1. Juha käy aina lauantaina (TORI). 2. Juna saapuu (ASEMA). 3. Olemme (HELSINKI). 4. (MIKÄ KATU) te asutte?

Lisätiedot

Sisällysluettelo Table of contents

Sisällysluettelo Table of contents Sisällysluettelo Table of contents OTC:n Moodlen käyttöohje suomeksi... 1 Kirjautuminen Moodleen... 2 Ensimmäinen kirjautuminen Moodleen... 2 Salasanan vaihto... 2 Oma käyttäjäprofiili... 3 Työskentely

Lisätiedot

JUJUPRIX 2015. Kalle Tuominen & Timo Mäkeläinen Markkinointiviestinnän suunnittelutoimisto Mainio Oy. kalle@mainiota.fi timo.makelainen@mainiota.

JUJUPRIX 2015. Kalle Tuominen & Timo Mäkeläinen Markkinointiviestinnän suunnittelutoimisto Mainio Oy. kalle@mainiota.fi timo.makelainen@mainiota. JUJUPRIX 2015 Kalle Tuominen & Timo Mäkeläinen Markkinointiviestinnän suunnittelutoimisto Mainio Oy kalle@mainiota.fi timo.makelainen@mainiota.fi Tampere matkailukohteena. Tampere on Pohjoismaiden suurin

Lisätiedot

BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET.

BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET. BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET. Pekka Ollikainen Open Source Microsoft CodePlex bio Verkkosivustovastaava Suomen Sarjakuvaseura

Lisätiedot

Nimeni on. Tänään on (pvm). Kellonaika. Haastateltavana on. Haastattelu tapahtuu VSSHP:n lasten ja nuorten oikeuspsykiatrian tutkimusyksikössä.

Nimeni on. Tänään on (pvm). Kellonaika. Haastateltavana on. Haastattelu tapahtuu VSSHP:n lasten ja nuorten oikeuspsykiatrian tutkimusyksikössä. 1 Lapsen nimi: Ikä: Haastattelija: PVM: ALKUNAUHOITUS Nimeni on. Tänään on (pvm). Kellonaika. Haastateltavana on. Haastattelu tapahtuu VSSHP:n lasten ja nuorten oikeuspsykiatrian tutkimusyksikössä. OSA

Lisätiedot

Ostamisen muutos muutti myynnin. Technopolis Business Breakfast 21.8.2014

Ostamisen muutos muutti myynnin. Technopolis Business Breakfast 21.8.2014 Ostamisen muutos muutti myynnin Technopolis Business Breakfast 21.8.2014 Taking Sales to a Higher Level Mercuri International on maailman suurin myynnin konsultointiyritys. Autamme asiakkaitamme parantamaan

Lisätiedot

Hankkeen toiminnot työsuunnitelman laatiminen

Hankkeen toiminnot työsuunnitelman laatiminen Hankkeen toiminnot työsuunnitelman laatiminen Hanketyöpaja LLP-ohjelman keskitettyjä hankkeita (Leonardo & Poikittaisohjelma) valmisteleville11.11.2011 Työsuunnitelma Vastaa kysymykseen mitä projektissa

Lisätiedot

3. Ryhdy kirjoittamaan ja anna kaiken tulla paperille. Vääriä vastauksia ei ole.

3. Ryhdy kirjoittamaan ja anna kaiken tulla paperille. Vääriä vastauksia ei ole. 1 Unelma-asiakas Ohjeet tehtävän tekemiseen 1. Ota ja varaa itsellesi omaa aikaa. Mene esimerkiksi kahvilaan yksin istumaan, ota mukaasi nämä tehtävät, muistivihko ja kynä tai kannettava tietokone. Varaa

Lisätiedot

Miten koulut voivat? Peruskoulujen eriytyminen ja tuki Helsingin metropolialueella

Miten koulut voivat? Peruskoulujen eriytyminen ja tuki Helsingin metropolialueella Miten koulut voivat? Peruskoulujen eriytyminen ja tuki Helsingin metropolialueella 26.4.2012 1 "There is often a property bubble around catchment areas. If a school makes a house more saleable or desirable,

Lisätiedot

Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site

Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Lab SBS3.FARM_Hyper-V - Navigating a SharePoint site Note! Before starting download and install a fresh version of OfficeProfessionalPlus_x64_en-us. The instructions are in the beginning of the exercise.

Lisätiedot

ASCII-taidetta. Intro: Python

ASCII-taidetta. Intro: Python Python 1 ASCII-taidetta All Code Clubs must be registered. Registered clubs appear on the map at codeclubworld.org - if your club is not on the map then visit jumpto.cc/18cplpy to find out what to do.

Lisätiedot

Työssäoppimassa Tanskassa

Työssäoppimassa Tanskassa Työssäoppimassa Tanskassa Taustatietoja kohteesta: Herning- kaupunki sijaitsee Tanskassa Keski- Jyllannissa. Herningissä asukkaita on noin. 45 890. Soglimt koostuu yhteensä 50 hoitopaikasta. Soglimtissa

Lisätiedot

Hyppy tulevaisuuteen millaista osaamista tarvitaan?

Hyppy tulevaisuuteen millaista osaamista tarvitaan? Hyppy tulevaisuuteen millaista osaamista tarvitaan? Menestyjäksi elinikäisellä oppimisella webinaari 12.12.2011 Johanna Ollila, Tulevaisuuden tutkimuskeskus Turun yliopisto MILTÄ TULEVAISUUS NÄYTTÄÄ? MITEN

Lisätiedot

GEENEISTÄ SOSIAALISEEN KÄYTTÄYTYMISEEN. Markus Jokela, Psykologian laitos, HY

GEENEISTÄ SOSIAALISEEN KÄYTTÄYTYMISEEN. Markus Jokela, Psykologian laitos, HY GEENEISTÄ SOSIAALISEEN KÄYTTÄYTYMISEEN Markus Jokela, Psykologian laitos, HY Akateeminen tausta EPIDEMIOLOGIA - PhD (tekeillä...) UNIVERSITY COLLEGE LONDON PSYKOLOGIA -Fil. maisteri -Fil. tohtori KÄYTTÄYTYMISTIETEELLINE

Lisätiedot

Mindfulness-kerho Mielekäs

Mindfulness-kerho Mielekäs Mindfulness-kerho Mielekäs Hyväksyntä 17.03.2015 LK Oskari Ventilä Mitä mindfulness on? suomeksi tietoinen läsnäolo tarkoittaa huomion tarkoituksellista kiinnittämistä vallitsevaan hetkeen, lempeällä ja

Lisätiedot

Mun/miun nimi on Paul. Mikä sun/siun nimi on? Mun/miun nimi on Jani. minun, mun, miun nimeni my name sinun, sun, siun nimesi your name

Mun/miun nimi on Paul. Mikä sun/siun nimi on? Mun/miun nimi on Jani. minun, mun, miun nimeni my name sinun, sun, siun nimesi your name 1 MINÄ ITSE MAAT, KIELET ja KANSALAISUUDET TERVEHDYKSET ----------------------------------------------------------------------------------------------------------------------------------------------- Paul

Lisätiedot

LAUSEEN KIRJOITTAMINEN. Peruslause. aamu - minä - syödä muro - ja - juoda - kuuma kahvi Aamulla minä syön muroja ja juon kuumaa kahvia.

LAUSEEN KIRJOITTAMINEN. Peruslause. aamu - minä - syödä muro - ja - juoda - kuuma kahvi Aamulla minä syön muroja ja juon kuumaa kahvia. LAUSEEN KIRJOITTAMINEN Peruslause aamu - minä - syödä muro - ja - juoda - kuuma kahvi Aamulla minä syön muroja ja juon kuumaa kahvia. minä - täti - ja - setä - asua Kemi Valtakatu Minun täti ja setä asuvat

Lisätiedot

Esikaupallisesti ratkaisu ongelmaan. Timo Valli 58. ebusiness Forum 21.5.2013

Esikaupallisesti ratkaisu ongelmaan. Timo Valli 58. ebusiness Forum 21.5.2013 Esikaupallisesti ratkaisu ongelmaan Timo Valli 58. ebusiness Forum 21.5.2013 Today we're still just scratching the surface of what's possible Technology should do the hard work so that people can get on

Lisätiedot

Ilonan ja Haban aamu Pariskunnalle tulee Aamulehti, mutta kumpikaan ei lue sitä aamulla: ei ehdi, eikä jaksa edes lähteä hakemaan lehteä kauempana sijaitsevasta postilaatikosta. Haba lukee Aamulehden aina

Lisätiedot

epäsuora esitys ilmoittaa jälkikäteen, mitä joku sanoo tai sanoi

epäsuora esitys ilmoittaa jälkikäteen, mitä joku sanoo tai sanoi EPÄSUORA ESITYS epäsuora esitys ilmoittaa jälkikäteen, mitä joku sanoo tai sanoi tyypillisesti epäsuoraa esitystä käytetään viestin välittämiseen, kirjan / lehden tms. selostamiseen, kertomaan mitä joku

Lisätiedot

VÄLITTÄMISESTÄ. Lasse Siurala

VÄLITTÄMISESTÄ. Lasse Siurala VÄLITTÄMISESTÄ Lasse Siurala Välittäminen on myös sitä, että rakennetaan keskinäisen huolehtimisen yhteisöjä, jossa nuori ei ole pelkkä tuen kohde vaan aktiivinen osa solidaarista yhteiskuntaa. VÄLITTÄMINEN

Lisätiedot

Terveisiä Poutapilvestä! Kesä sujui Imatralla oikein mukavasti. Sää oli vaihteleva koko Suomessa ja niin meilläkin. Välillä satoi ja välillä paistoi.

Terveisiä Poutapilvestä! Kesä sujui Imatralla oikein mukavasti. Sää oli vaihteleva koko Suomessa ja niin meilläkin. Välillä satoi ja välillä paistoi. 2007 Terveisiä Poutapilvestä! Kesä sujui Imatralla oikein mukavasti. Sää oli vaihteleva koko Suomessa ja niin meilläkin. Välillä satoi ja välillä paistoi. Nyt on hyvä muistella mennyttä kesää ja sen tapahtumia.

Lisätiedot

VERBI + TOINEN VERBI = VERBIKETJU

VERBI + TOINEN VERBI = VERBIKETJU VERBI + TOINEN VERBI = VERBIKETJU 1. Apuverbi vaatii seuraavan verbin määrämuotoon. Lisää verbi luettelosta ja taivuta se oikeaan muotoon. Voimme Me haluamme Uskallatteko te? Gurli-täti ei tahdo Et kai

Lisätiedot

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Arkkitehtuuritietoisku eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä Esikysymys Kuinka moni aikoo suunnitella projektityönsä arkkitehtuurin? Onko tämä arkkitehtuuria?

Lisätiedot

1. HYVÄ YSTÄVÄ. Ystävällinen Iloinen Luotettava Avulias Rehellinen Reipas Ei juorua Osaa pitää salaisuudet

1. HYVÄ YSTÄVÄ. Ystävällinen Iloinen Luotettava Avulias Rehellinen Reipas Ei juorua Osaa pitää salaisuudet 1. HYVÄ YSTÄVÄ Ystävällinen Iloinen Luotettava Avulias Rehellinen Reipas Ei juorua Osaa pitää salaisuudet 2 2. HYVÄ YSTÄVÄ Oletko itse ystävänä sellainen, minkä ominaisuuden kirjoitit? a. En koskaan 0

Lisätiedot

Security server v6 installation requirements

Security server v6 installation requirements CSC Security server v6 installation requirements Security server version 6.4-0-201505291153 Pekka Muhonen 8/12/2015 Date Version Description 18.12.2014 0.1 Initial version 10.02.2015 0.2 Major changes

Lisätiedot

9.1. Mikä sinulla on?

9.1. Mikä sinulla on? 9.kappale (yhdeksäs kappale) 9.1. Mikä sinulla on? Minulla on yskä. Minulla on nuha. Minulla on kuumetta. Minulla on kurkku kipeä. Minulla on vesirokko. Minulla on flunssa. Minulla on vatsa kipeä. Minulla

Lisätiedot

Esimerkkinä http://wordpress.com/ - ilmainen blogi-julkaisujärjestelmä. WordPress:stä on myös palvelimelle asennettava versio (WordPress.

Esimerkkinä http://wordpress.com/ - ilmainen blogi-julkaisujärjestelmä. WordPress:stä on myös palvelimelle asennettava versio (WordPress. BLOGIN LUOMINEN Esimerkkinä http://wordpress.com/ - ilmainen blogi-julkaisujärjestelmä. WordPress:stä on myös palvelimelle asennettava versio (WordPress.org) Myös http://blogspot.com on ilmainen ja helppokäyttöinen

Lisätiedot

SUOKI TOIMINTA PASSI

SUOKI TOIMINTA PASSI I K O SU M I TO A T IN A P I SS nimi: Näitä taitoja, joita harjoittelet tässä passissa, sinä tarvitset: A Työharjoittelussa B Vapaa-aikana C Koulussa Nämä taidot kehittyvät, kun teet tehtävät huolellisesti:

Lisätiedot

MILLOIN PARTITIIVIA KÄYTETÄÄN? 1. NEGATIIVINEN LAUSE o Minulla ei ole autoa. o Lauralla ei ole työtä. o En osta uutta kännykkää.

MILLOIN PARTITIIVIA KÄYTETÄÄN? 1. NEGATIIVINEN LAUSE o Minulla ei ole autoa. o Lauralla ei ole työtä. o En osta uutta kännykkää. MILLOIN PARTITIIVIA KÄYTETÄÄN? 1. NEGATIIVINEN LAUSE o Minulla ei ole autoa. o Lauralla ei ole työtä. o En osta uutta kännykkää. 2. NUMERO (EI 1) + PARTITIIVI o Minulla on kaksi autoa. o Kadulla seisoo

Lisätiedot

Lakimies PDF. ==>Download: Lakimies PDF ebook

Lakimies PDF. ==>Download: Lakimies PDF ebook Lakimies PDF ==>Download: Lakimies PDF ebook Lakimies PDF - Are you searching for Lakimies Books? Now, you will be happy that at this time Lakimies PDF is available at our online library. With our complete

Lisätiedot

Vesitehokkuus liiketoiminnan uusi ajuri. Pöyry Forest Industry Consulting oy

Vesitehokkuus liiketoiminnan uusi ajuri. Pöyry Forest Industry Consulting oy Vesitehokkuus liiketoiminnan uusi ajuri Pöyry Forest Industry Consulting oy Sisältö 1. Vesiparadoksi 2. Vesi ja hiili 3. Projekti Geysiiri 2 Vesitehokkuus - liiketoiminnan uusi ajuri 1. Vesiparadoksi Veden

Lisätiedot

ENGLISH 1 A1 alkeet, 1. kappale M.A. Tehtävien symbolit: vihkotehtäviä kielioppi

ENGLISH 1 A1 alkeet, 1. kappale M.A. Tehtävien symbolit: vihkotehtäviä kielioppi ENGLISH 1 A1 alkeet, 1. kappale M.A. Tehtävien symbolit: vihkotehtäviä kielioppi Keskustelutehtävä Kertaustehtäviä Sanasto 1. Friends. Thom is a new boy in school. No-one knows him. Thom doesn t have any

Lisätiedot

WITNESS SUPPORT THE FINNISH EXPERIENCE

WITNESS SUPPORT THE FINNISH EXPERIENCE WITNESS SUPPORT THE FINNISH EXPERIENCE T i i n a R a n t a n e n R e g i o n a l M a n a g e r, V i c t i m S u p p o r t F i n l a n d 17.6.2013 1 VS FINLAND S SERVICES Help line (nation wide) Mon - Tue

Lisätiedot

LET S GO! 5 KOEALUE 4-6 Nähnyt:

LET S GO! 5 KOEALUE 4-6 Nähnyt: 1 LET S GO! 5 KOEALUE 4-6 Nähnyt: On jälleen tullut aika testata osaamisesi. Koekappaleina ovat kappaleet 7-9. Muista LUKEA KAPPALEITA ÄÄNEEN useaan otteeseen ja opetella erityisen hyvin KUVASANASTOT ja

Lisätiedot

Vnitřní lokální pády statický: inessiv ssa směr od: elativ sta směr do: illativ Vn, -hvn, -seen

Vnitřní lokální pády statický: inessiv ssa směr od: elativ sta směr do: illativ Vn, -hvn, -seen Vnitřní lokální pády statický: inessiv ssa směr od: elativ sta směr do: illativ Vn, -hvn, -seen Vytvoř elativ: Minä olen kotoisin Tšekistä (Tšekki). Hän on kotoisin Suomesta (Suomi). Oletko sinä kotoisin

Lisätiedot

Analyysimenetelmät kouluopetuksessa: Spektrofotometri. FM Marja Happonen Kemian opetuksen keskus Kemian laitos Helsingin yliopisto

Analyysimenetelmät kouluopetuksessa: Spektrofotometri. FM Marja Happonen Kemian opetuksen keskus Kemian laitos Helsingin yliopisto Analyysimenetelmät kouluopetuksessa: Spektrofotometri FM Marja Happonen Kemian opetuksen keskus Kemian laitos Helsingin yliopisto Mi;ausautomaa

Lisätiedot

Kytäjä Golf ry Seniorikysely Helmikuu 2015

Kytäjä Golf ry Seniorikysely Helmikuu 2015 Kytäjä Golf ry Seniorikysely Helmikuu 2015 Kytäjä Golf Ry:n Seniorikysely Ajankohta: Helmikuu 2015 Sähköpostiosoitteet: Kytäjä Golf Ry:n jäsenrekisteri Jäsenrekisterissä 1.2.2015 273 senioria (miehet 55v,

Lisätiedot

Rekisteröiminen - FAQ

Rekisteröiminen - FAQ Rekisteröiminen - FAQ Miten Akun/laturin rekisteröiminen tehdään Akun/laturin rekisteröiminen tapahtuu samalla tavalla kuin nykyinen takuurekisteröityminen koneille. Nykyistä tietokantaa on muokattu niin,

Lisätiedot

1. Gender - Sukupuoli N = 65. 2. Age - Ikä N = 65. Female Nainen. Male Mies 20-24 25-29 30-34 35-39 40-44 45-49 50-

1. Gender - Sukupuoli N = 65. 2. Age - Ikä N = 65. Female Nainen. Male Mies 20-24 25-29 30-34 35-39 40-44 45-49 50- Aalto Doctoral Programme in Science, Follow-up Questionnaire for Doctoral Students - Perustieteiden tohtoriohjelma, seurantakysely jatko-opiskelijoille (22 % answered to the questionnaire) 1. Gender -

Lisätiedot

Sosiaalinen Media Suomessa - nykyistä ja tulevaa

Sosiaalinen Media Suomessa - nykyistä ja tulevaa Sosiaalinen Media Suomessa - nykyistä ja tulevaa Taneli Tikka toimitusjohtaja IRC-Galleria.net Dynamoid Oy Technology changes while people's needs remain the same. When it comes to communication products,

Lisätiedot

o l l a käydä 13.1. Samir kertoo:

o l l a käydä 13.1. Samir kertoo: 13. kappale (kolmastoista kappale) SAMI RI N KOULUVII KKO 13.1. Samir kertoo: Kävin eilen Mohamedin luona. Hän oli taas sairas. Hänellä oli flunssa. Minä kerroin Mohamedille, että myös minulla on pää kipeä.

Lisätiedot

ETELÄESPLANADI 2 00130 HELSINKI

ETELÄESPLANADI 2 00130 HELSINKI 00130 HELSINKI MODERNIA TOIMISTOTILAA Noin VUOKRATAAN Ainutlaatuinen tilaisuus vuokrata huipputason Helsingin näköalapaikalta Toimi pian! Lisätietoja KALLE JASKARA Myyntijohtaja +358 50 324 0404 kalle.jaskara@tkoy.fi

Lisätiedot

FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation

FinFamily Installation and importing data (11.1.2016) FinFamily Asennus / Installation FinFamily Asennus / Installation 1 Sisällys / Contents FinFamily Asennus / Installation... 1 1. Asennus ja tietojen tuonti / Installation and importing data... 4 1.1. Asenna Java / Install Java... 4 1.2.

Lisätiedot

Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi.

Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi. SOSIAALINEN MEDIA Tässä ohjeessa käydään läpi sosiaalisen median verkkopalveluiden lisätoimintojen lisääminen verkkosivuillesi. FACEBOOK Facebook mahdollistaa useiden erilaisten Social plugins -toimintojen

Lisätiedot

6. Vastaa kysymyksiin Onko sinulla isoveli? Oletko sinä lyhyt? Minkä väriset hiukset sinulla on? Onko sinulla siniset silmät? Oletko nyt iloinen?

6. Vastaa kysymyksiin Onko sinulla isoveli? Oletko sinä lyhyt? Minkä väriset hiukset sinulla on? Onko sinulla siniset silmät? Oletko nyt iloinen? 5. Vastaa kysymyksiin (kpl1) Onko sinulla sisaruksia? Asuuko sinun perhe kaukana? Asutko sinä keskustan lähellä? Mitä sinä teet viikonloppuna? Oletko sinä viikonloppuna Lahdessa? Käytkö sinä usein ystävän

Lisätiedot

Varsan markkinointi 2.0 - webin muuttuvat mahdollisuudet. Marika Pöyri 13.2.2009 Lappeenranta Jalostuspäivät

Varsan markkinointi 2.0 - webin muuttuvat mahdollisuudet. Marika Pöyri 13.2.2009 Lappeenranta Jalostuspäivät Varsan markkinointi 2.0 - webin muuttuvat mahdollisuudet Marika Pöyri 13.2.2009 Lappeenranta Jalostuspäivät Miksi myynti-ilmoitus Hevosurheilussa ei riitä? [In] the last hundred years the way to get into

Lisätiedot

Naisnäkökulma sijoittamiseen. 24.3.2007 Vesa Puttonen

Naisnäkökulma sijoittamiseen. 24.3.2007 Vesa Puttonen Naisnäkökulma sijoittamiseen 24.3.2007 Vesa Puttonen Miten sukupuolella voi olla mitään tekemistä sijoittamisen kanssa??? Naiset elävät (keskimäärin) pidempään kuin miehet Naiset saavat (keskimäärin) vähemmän

Lisätiedot

No Problem TARJOTTIMET 1.3.2012

No Problem TARJOTTIMET 1.3.2012 No Problem TARJOTTIMET 1.3.2012 Tuotetietoja Kaikki No Problem tarjottimet on käsintehtyjä, tuote kerrallaan. Yhdessä tarjottimessa voi olla jopa 8 kerrosta viilua, koosta riippuen. Paikallisesti valmistettu

Lisätiedot

Herään aikaisin aamulla herätyskellon pirinään. En jaksanut millään lähteä kouluun, mutta oli aivan pakko. En syönyt edes aamupalaa koska en olisi

Herään aikaisin aamulla herätyskellon pirinään. En jaksanut millään lähteä kouluun, mutta oli aivan pakko. En syönyt edes aamupalaa koska en olisi Akuliinan tarina Herään aikaisin aamulla herätyskellon pirinään. En jaksanut millään lähteä kouluun, mutta oli aivan pakko. En syönyt edes aamupalaa koska en olisi muuten kerennyt kouluun. Oli matikan

Lisätiedot

812336A C++ -kielen perusteet, 21.8.2010

812336A C++ -kielen perusteet, 21.8.2010 812336A C++ -kielen perusteet, 21.8.2010 1. Vastaa lyhyesti seuraaviin kysymyksiin (1p kaikista): a) Mitä tarkoittaa funktion ylikuormittaminen (overloading)? b) Mitä tarkoittaa jäsenfunktion ylimääritys

Lisätiedot

SM Kuvagalleria www.saunamafia.fi 23.4.2011 1/12

SM Kuvagalleria www.saunamafia.fi 23.4.2011 1/12 www.saunamafia.fi 23.4.2011 1/12 Lähtötunnelmissa Heikki, Ari, Jani ja Erkki. Jäsenemme Larissakin tavattiin kentällä. Elvikin pääsi kuvaan. Tällä koneella lennettiin. Philip ja Aija-Riitta. Tästä se sitten

Lisätiedot

Start- upista kanna-avaksi yritykseksi

Start- upista kanna-avaksi yritykseksi Start- upista kanna-avaksi yritykseksi Reijo Syrjäläinen Gorilla Ventures Oy Lesson # 1 Product to Market Fit!!! Technology Adoption Life-Cycle Tornado Main Street Early Market " THE CHASM Bowling Alley

Lisätiedot

ICES: 110 vuotta tiedettä ja merentutkimusta: Mitä ja miksi? Dr. Kai Myrberg ICES Delegaatti Helsinki 18.03.2014

ICES: 110 vuotta tiedettä ja merentutkimusta: Mitä ja miksi? Dr. Kai Myrberg ICES Delegaatti Helsinki 18.03.2014 ICES: 110 vuotta tiedettä ja merentutkimusta: Mitä ja miksi? Dr. Kai Myrberg ICES Delegaatti Helsinki 18.03.2014 Mikä ihmeen ICES? Mikä on ICES? (International Council for the Exploration of the Sea) (Kansainvälinen

Lisätiedot

SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko.

SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko. SUBSTANTIIVIT 1/6 juttu joukkue vaali kaupunki syy alku kokous asukas tapaus kysymys lapsi kauppa pankki miljoona keskiviikko käsi loppu pelaaja voitto pääministeri päivä tutkimus äiti kirja SUBSTANTIIVIT

Lisätiedot

Työharjoittelu Saksassa - Kleve 19.4.2014 Työharjoittelu paikka - Kleidorp Ajankohta 1.3 11.4.2014

Työharjoittelu Saksassa - Kleve 19.4.2014 Työharjoittelu paikka - Kleidorp Ajankohta 1.3 11.4.2014 Stephar Stephar Matkaraportti Työharjoittelu Saksassa - Kleve 19.4.2014 Työharjoittelu paikka - Kleidorp Ajankohta 1.3 11.4.2014 Tässä matkaraportista yritän kertoa vähän, että miten minulla meni lentomatka,

Lisätiedot

Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat

Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Tarua vai totta: sähkön vähittäismarkkina ei toimi? 11.2.2015 Satu Viljainen Professori, sähkömarkkinat Esityksen sisältö: 1. EU:n energiapolitiikka on se, joka ei toimi 2. Mihin perustuu väite, etteivät

Lisätiedot

HS:n taitopolku. 1) Visio täydellisestä suorituksesta. 2) Suunnistustaito oma oivallus. 3) Rastiväli kerrallaan ja leuka ylös, HS:n taitokirja

HS:n taitopolku. 1) Visio täydellisestä suorituksesta. 2) Suunnistustaito oma oivallus. 3) Rastiväli kerrallaan ja leuka ylös, HS:n taitokirja HS:n taitopolku 1) Visio täydellisestä suorituksesta 2) Suunnistustaito oma oivallus 3) Rastiväli kerrallaan ja leuka ylös, HS:n taitokirja 4) Vinkkejä Visio täydellisestä suorituksesta Hyvä puhdas suunnistus

Lisätiedot

Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE

Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE November 7, 2014 Paula Kilpinen 1 7.11.2014 Aalto University

Lisätiedot

Henkilökohtainen apu englantilaisessa tutkimuksessa

Henkilökohtainen apu englantilaisessa tutkimuksessa Henkilökohtainen apu englantilaisessa tutkimuksessa Teppo Kröger Jyväskylän yliopisto Keski-Suomen vammaispalveluhanke Päätösseminaari, Jyväskylä 12.9.2008 Esityksen runko Brittiläinen vammaistutkimus

Lisätiedot