Kulti- Sanomat. Suomenkieliset. Kulti ry. - Kuopion yliopisto, elokuu 2000

Koko: px
Aloita esitys sivulta:

Download "Kulti- Sanomat. Suomenkieliset. Kulti ry. - Kuopion yliopisto, elokuu 2000"

Transkriptio

1 Kulti ry. - Kuopion yliopisto, elokuu 2000 Suomenkieliset Kulti- Sanomat Tässä numerossa mm: Paljastavat tutori-esittely, HP- bingo, Kalakukon syöntiohjeita, Semikavntitatiivista tutkimusta, AATU- raportti ja PJ:n palsta. Varoitus: Saattaa sisältää tarttuvaa biohuumoria!

2 Sisälmysluettelo: Kulti-sanomat Paheenjohtajan väsynyt palsta 4 Viileät tutoriesittelyt 6 Opiskelijapappa Turggusess 7 Kalakukon syöntiohje 8 Muutama haaska sana savolaesista 10 Journal of Semiquantitative Research 12 Luentobingo 13 Exothermic Hell? 14 Elämää ykkösellä! 16 Tapahtumakalenteri Julkaisee Kulti ry. Tämän numeron teossa on käytetty opiskelijoita, kieroutuneutta huumoria ja reipasta Kulti-henkeä. Kuten aina, toimitus ei vastaa mistään, ei kenellekään eikä paljasta lähteitään. Lehden aiheuttamia henkisiä kärsimyksiä ei korvata. Pääsyylliset: Rädyn Jani, BT4, Korjamon Tinippa SB4, Varjosalon Markku SB3, Team Tuskan henkinen perintö, JKR- systems ja Spirit of Kulti. (Taas kerran, huokaus.) Totuus on aina ulkona. 2

3 Pj:n palsta Taas on koittanut se aika vuodesta kun ihmiset alkavat palailemaan hiljalleen yliopistolle päin. Kesäloma/työ on takana ja nyt on aika treenata istumalihaksia luennoilla, jos siis meinaa että opintotuki kolahtaa tilille. Yliopisto täyttyy opiskelijoista fukseista ännänteen vuosikurssiin. On taas huvittavaa katsella fuksien suunnistusta ja harhailua ympäri laajaa kampustamme. Mutta älkää pelätkö fuksit, äkkiä te kotiudutte akateemiseen maailmaan ja onhan teillä oppaina tutorit (valitettavasti myös allekirjoittanut :). Teiltä fukseilta ja miksei vanhoiltakin ei vaadita muuta kuin aktiivisuutta. Opiskelu ajanhan pitäisi olla elämämme parasta aikaa. Kotiin TV:n ääreen ehdit jämähtämään keski-ikäisenäkin. Nyt on aika harrastaa kulttuuria, harrastaa liikuntaa, osallistua ainejärjestötoimintaan ja opiskelijabileisiin, viettää unohtumattomia hetkiä opiskelijatovereiden kanssa filosofisten keskustelujen parissa pikkutunneilla, saunoa vaihtooppilaiden kanssa, osallistua ylioppilaskunnan eri sektoreiden toimintaan tai vaikka perustaa oman kerhon. Tärkeintä on että teet mitä tykkäät, mutta olet partiolaisen tavoin aina valmis uusiin haasteisiin. Kaiken tekemisen ohessa täytyisi kuitenkin löytää aikaa opiskeluun, sitä vartenhan me kuulemma olemme yliopistossa kirjoilla. Välillä loputtoman tuntuisen informaatiotulvan tankkaaminen päähän voi tuntua toivottomalta urakalta, kunnes yhtäkkiä huomaatkin valmistuneesi. Paljon työtä se kuitenkin vaatii ja kriittisyyttä. Onko kaikki tämä tieto tarpeellista? Ovatko talon tavat opiskelijaystävällisiä? Onko ainejärjestön ja/tai ylioppilaskunnan toiminta puutteellista tai muuten vaan huonoa. Epäkohtiin kannattaa puuttua heti ja suoraan! Kriittisyys ja asioiden kyseenalaistaminenhan on tieteissä aivan keskeistä. Toivottavasti ehdit kaiken touhaamisesi keskellä tutustua uusiin ihmisiin ja ylläpitää yhteyttä ystäviisi, niin uusiin kuin vanhoihin. Näin lopuksi haluan toivottaa kaikille kultilaisille ja miksei muillekin tapahtumarikasta syksyä! Markku Varjosalo, PJ Those who survived the San Francisco earthquake said, Thank God, I m still alive. But, of course, those who died, their lives will never be the same again. Sen. Barbara Boxer, (D, Calif.) 3

4 Bodanneet ja leveästi eläneet kuumat tutorimme. Miika Heinonen Juulia Enbäck Pirtsakka Juulia on jo pienestä pitäen ollut oikea vesipeto, harrastuksina hänellä on ollut jo useiden vuosien ajan mm. kuviokellunta ja uppopallo. Vannoutuneena Kauniit ja Rohkeat fanina, hän on ollut jo viisi vuotta Kuopion faniosaston puheenjohtaja. Juulia tienaa sivutöinään rahaa hiusmallina olostaan L Orielilla ja hiuksistaan hänet tunnetaankin. Miika Miksuli Heinonen on vanhan suomalaisen perinnepainin, Nurmipainin vakaa harrastaja. Eelis Rytkösen jalanjälkiä seuraava Miika on hävinnyt piiriotteluistaan vain yhden. Talvikaudella Miika keskittyy toiseen harrastukseensa, kehäcurlingiin. Kuopion Curlaajiin otetaankin jatkuvasti uusia jäseniä. Vietettyään kesän töissä Primalcossa ovat Miikan harrastuksiin kuuluneet myös Tsekkoslovakialaiset viinit. Sanna Syrjäläinen Sannan akateeminen luonne juontaa jo hänen lapsuuteensa Turun tähtitornin juurelle, jossa nuori Sanna etsi pulsareita kiikareillaan. Kun pulsareita ei löytynyt, eristi viisi-vuotias Sanna ensimmäisen genominsa läheisestä ruusupusikosta. Kalliokiipeily tuo Sannan elämään jännitystä, kuten myös hänen lemmikkinään olevat kaksi bernhardilaista ja booa. Korkeasaari-kesän jälkeen Sanna menetti sydämensä lumileopardeille. Mikko Sairanen Mikko Sande Sairanen, harrastaa, kuten kaikki saunassa olivat ovat huomanneet, kehonrakennusta. Tämä tatuoitu ja lävistelty miekkonen on päässyt myös televisioon, Henry Saaren pakarastunttina! Biotekniikkaan Mikko sai kipinän, kun hänen DNA- näytteensä päätyi ensimmäisenä Turusta KRP:n arkistoihin. Monessa mukana ollut Mikko on myös Kybbo:n pj ja muutenkin mukava mies. Mutta älkää mainitko hänelle mitään hänen murteestaan! 4

5 Salla Keskitalo Salla, Turun ulkosaariston Gyltö:stä kotoisin olevana, on tottunut purjehtija, jopa mestaruustasolla. Kuopion Njep-De- Do- seuran uskollisena rahastonhoitajana toiminut Salla rentoutuu mielellään hoitamalla akvaariokalojaan ja tekemällä sushia. Sallan ura suuntaa jo vakaasti Vesigenetiikan instituuttiin Kuopion AIVI:ssa, ainakin kesätöistä päätellen. Markku Varjosalo Markku Vartsa Varjosalo, Kultin pj:näkin tunnettu, on jo pitkän linjan luontoaktiivi. Jo muinoin Talaskankaan hakkuuaukeilla köyttäytynyt Markku on Kuopion lintubongareiden KuLiBo:n aktiiveja. Vaikka nyttemmin Markku on leikannut partansa ja siistinyt hiuksensa, saattaa puheesta silloin tällöin vielä kajahtaa entistä luontohenkeä. Harva tietää, että Markku on ensimmäinen suomalainen koskinuoluvästäräkin havaitsija! Eeva Kuosmanen Tämä tyttö on lukenut ympäristötietoisena opiskelijana Ekologisen ympäristötieteen laitoksella mm. puistokemiaa ja maisemointia. Vapaa-aikanaan Eeva suunnittelee WAPprotocollia ja JaVa- ohjelmia Nokialle, vaikka hän onkin vaihtanut seksikkään IT- alan hehkuvan seksikkääseen BB- alaan. Kuopioon Eeva sopii kuin lusikka silmään, onhan hän aina halunnut olla Savolainen. You can t just let nature run wild. Wally Hickel, former governor of Alaska The Stupidist Things Ever Said By Politicians - by Ross and Kathryn Petras It isn t pollution that is hurting the environment, it s the impurities in our air and water that are doing it. -Dan Quayle It s time for the human race to enter the solar system! Dan Quayle, on the concept of a manned mission to Mars The Holocaust was an obscene period in our nation s history. I mean in this century s history. But we all lived in this century. I didn t live in this century. Senator Dan Quayle The loss of life will be irreplaceable. Vice President Dan Quayle 5

6 Opiskelijapappa Turussa vielä osaa paikallisen paperilennokkiyhdistyksen kisaan. Vielä ovat ammattilaiset kovempia, mutta tiukasti vastaan hangoitelleet kuopiolaiset lupaavat parantaa ensi vuonna. Häääähhh! Radiosta tulvii korviin Katri- Helunaa tai jotain muuta humppaa. Silmäluomet avautuvat hitaasti. Mitä ihmettä? Kellohan on vasta kuusi? Päässä takoo hieman, mutta sitten selkenee: Tänään mennään Turkuun!!! Ilme kirkastuu ja nivelet naristen kolmannen vuosikurssin opiskelija singahtaa sängystään kuin joskus muinoin fuksivuotenaan. Pienen bussimatkan jälkeen iloinen seurue saapuu Turun yliopiston virkistyspaikkaan jossain saaristossa. Opiskelijapappa hieraisee silmiään, onhan muuten upea paikka! Ilta kuluukin grillaillessa, lettuja paistaessa, jalkapalloa ja lentopalloa pelaillessa sekä tietysti ankarasti saunoessa. Yöpuulle YO-kylän kerhohuoneelle huoleton joukkio saapuu ennen kahta ja kohta kuuluu ympäriltä tasainen tuhina. Opiskelijapappakin vaipuu uneen. Pikaisen aamupalan jälkeen sankarimme on valmis iskemään mäkeä alas kimaltelevassa punaisessa haalarissaan. Rinkka selkään, arskat päähän ja menoksi. Matka koululle tuntuu yllättävän lyhyeltä toisen monet kokeneen biotieteilijän kanssa. Mutta eihän tänne nukkumaan tultu. Kahdeksan aikoihin singahdetaan enemmän tai vähemmän virkeinä ylös ja ryhdytään laittautumaan matkan pääkoitoksia varten. Myönnettävä on, ettei retkipatja kovalla lattialla vedä vertoja kaksoisjousitetulle runkopatjalle. Bussi ehti odottaa kahta sankariamme kymmenisen minuuttia ennen lopullista kytkimen nostoa. Reissun päällä alkaa tunnelma keventyä varsin pikaisesti, varsinkin ikiopiskelijoiden kansoittamalla takapenkillä. Matkan aikana pyörii kait elokuvia, mutta takaosissa eri opiskelijasukupolvet (I, II ja III vuosikurssi) keskittyvät lyömään korttia taidelasi panoksena. Yllättävän nopeasti ohitamme Posankan ja saavumme kemian laitoksen pihaan, komea pytinki muuten. Turun Amica pistää jopa Kuopion serkkuaan pahemmaksi. Onneksi pääsemme pian kokemaan historian ensimmäisen AY-juoksun huuman aivan fantastisessa säässä. Muutaman rastin ja viestin jälkeen eräät excuilijat ottavat Juvantia Pharma ja Hormos Medical esittäytyvät kalvosulkeisten muodossa. Kumma excu, kun kukaan ei näytä olevan krapulassa. Vielä pieni pyörähdys biotekniikan laitoksella, jonka jälkeen siirrymme odottamaan vesi kielellä AATUa eli Akateemista AurajokilaivuriTUtkintoa. Tällä kertaa Amica pisti paljon, paljon paremmaksi kuvun täyttämisessä. Ilma on jälleen kuin morsian. Kokeneet ketut ottavat varaslähdön ja välttävät muutaman jokilaivan ajan pahimmat jonot. Eivätkä ne loppujen lopuksi niin pahoja ole kuin miltä näyttävät. Osa suorittaa Kapteenin, osa I Perämiehen, jotkut tyytyvät Matruusin arvonimeen, muutamat nauttivat muuten vaan säästä ja seurasta. Urakan jälkeen vanhat parrat tekevät kulttuurimatkan torin Hesburgeriin. Iltabileet ovat Marilynissä, joka lienee turkulainen sekoitus Maximia ja Clonea varustettuna jättimäisellä 6

7 peilipallolla. Aamulla singahdetaan jo paljon vaisummin ylös ja osa suuntaa saunaan. Löylyä ei tosin paljoa tarvitse heittää, sillä luomet ovat yllättävän raskaat. Siivousten ja kiitosten jälkeen ostetaan aamupalaa lähikaupasta ja aloitetaan taivallus kotiin. Matka tuntuu yllättävän pitkältä, mutta onneksi uni saa välillä vallan. Ja sen kyllä huomaa niskassa. Kotona varmastikin moni miettii, että ensi vuonna uudestaan. Ja onhan meillä jo lähes amiraaliainestakin The word genius isn t applicable in football. A genius is a guy like Norman Einstein. -Joe Theisman, quarterback and sports analyst Timo Korjamo Kalakukon naatintaohje: 1. Avvoo paketti 2. Poesta kiäreet 3. Ota asseeks iso veihti ja pien huarukka 4. Paa evvääs ettees topakalle pöyvälle (ei sua täristä) 5. Hätistä muut loetommalle (voep räeskyä) 6. Iske iso veihti kärki eillä keskelle kukon selekee ja leikkoo nykyttämällä eistaas kämmenes kokone aakko 7. Nosta lämpäre kättees, paa voeta piälle ja hujjaata iäntä kohti (Se olj vasta kuorta särpimeks) 8. Huokase ja raahotu 9. Ota huarukka ja kato kukon sissään(näläkäs on jo tolokuton, etkä sisällöstä taija suaha selevee?usko poes, eissäs on herkkuva: se mössö on aetoo savolaesta pikkelssijä oekeeta ahvenkalloo kylyki kylessä toesta killoo ja joka välissä sitä ihteesä eli ison punasilimäpossun kylykee (helekutin hyvvee läskijä,tolokuttoman nuukasti lihhoo!) 10. Paa rotteesit lassii ja silimäs kii 11. Lyö huarukkas syvälle hyvvään (Jottae saet kuitennii, kaekki se on syötävän hyvvee. Piä yhä silimäs kii, mutta varo ettet tökkee nennääs.) 12. Avvoos suus ja laeta lasti maeskuttimees 13. Suus kiinni, huarukka poes 14. Elä uattele vuan naati(koeta piättee, kummasta tykkeet enemmän, kukosta vai kalasta?eläkä hättäele, usko vuan: hyvvee se olj!) 15. Anna huarukan heiluva, ruotoja ei tarvihe pelätä 16. Huokase vällii, rööhtäse ja anna himon yltyvä(voe tokkiisa!! Ja jos näläkä jäe, niin ei ku alota vuan alusta!) 7

8 MUUTAMA SANA SAVOLAISISTA Palveluja hakemassa Yleissanastoa: Yksi = Yks Kaksi = Pari Kolme = Kolome Neljä = Ee iha viittä Viisi = Viis Kuusi = Kuus Seitsemän = Seehtemän Kahdeksan = Kaheksan Yhdeksän = Yheksän Kymmenen = Jonnii verran enemmän ku yheksä Kyllä = Jo tokkiisa! Ei = Ee... Olkaa hyvä! = Olokee hyvä! / Hek! Kiitos = Kiitoksija Anteeksi = Anteeks Ei kestä = Eepä kestä En ymmärrä = Mittee? Hetkinen = Outahan hollin aekoo Anteeksi, mitä sanoitte? = Mittee työ sanoja? Hyvää huomenta = Hyvvee huomenta Hyvää päivää = Hyvvee päevee Hyvää iltaa = Hyvvee iltoo / Hyvvee illanköllykkätä Hauska tavata! = No terve vuan terve! Apua! = Aattakee! Missä on wc? = Oesko tiällä vessoo jossaen Puhutteko suomea? = Huastellaanko sitä suomee? Paljonko se maksaa? = Mittees sinä siitä pyytäsit? Voinko maksaa tä11ä luottokortilla? = Mitteepä jos vinkasutat vissoo? Voisitteko kirjoittaa sen paperille? = Pistätkö kuule tähän ylös? Saisinko postimerkin kirjeeseen? = Ee kaet tämä merkitä kule! Haluaisin vuokrata polkupyörän = Ottasin munamankelin laenaan Milloin se on valmis? Tarvitsen sen huomisaamuksi = Jokohan tuon uamulla saes? Mitä kello on? = Mittee se kello tähän aekaan näättää Onko tämä Kuopion tori? = Mahettannoonko olla Kuopijon torilla? Ostaisin lipun = Ostasin piletin Haluaisin filmin tähän kameraan = Löötyskö vilimiä kameraan? Kauanko filmin kehittäminen kestää? = Millonka on kuvat valamiina? Missä kirkko sijaitsee? = Missee piruntorjuntapunkkerj on? Autossani on vika = Aato meenoo renata Mistä täältä voi ostaa Hugo Bossin valmistamia asusteita? = Mistee tiältä suap niitä Pomo-Huukon vuatteita? Voisitteko ottaa puhelun tähän numeroon? = Pirraatatko tähän numeroon? 8

9 Missä on lähin alkoholiliike? = Ossootko neovoo paekallisseen pitkäripaseen? Saanko oluen! = Toesijako kaljan! Saisinko paikallista olutta? = Oesko jottae tämänseuvun kaljoo? Kohteliaita sanontoja eri tilanteisiin Kulti-sanomat 2000 Pääsisinkö tästä ohitse? = Väestähän vähäsen Olen pahoillani, en polta = Osta vuan omat tupakkis Tarkoitukseni ei ollut loukata neitiä = Oo tässä akkoen mieliks! Ei, en sanonut teistä mitään = Mittees siinä toljotat? En toki haastaisi riitaa noin ison miehen kanssa = Outtele siinä, nunä kutun poejat! Anteeksi, ei ollut tarkoitus töniä = Mäne muuvalle siitä torottammaan! Olen pahoillani = Häh, mikä se Anteeksi häiriö = Kuulettako työ! Assistentti, minulla on väärä näyte!= Äejä, tämä aene o aevan tolokuttoma hajusta ja suattaapi olla, etteioo aevan ehtoo itteesäkään. Olet viehättävän näköinen neitokainen! = Sinnout läsäkän näkönen pimu! Menkää tiehenne! = Alakakee kalappia! Mitä tämä tarkoittaa? = Mittees se tämä meinoo? Taidan siirtyä inkuboimaan= Taijanpa lähtevä ottamaan nokoset Kultin kansikuvapojat kuumassa fanikuvassa! Kerää koko linssilude- sarja! 9

10 Journal of Semiquantitative Research: GM- vesi Olemme saanet luvan julkaista myös täällä Kulti-sanomissa maailmassa ja Kirgiisiassa suurta kohua herättäneen uraa-uurtavan tutkimuksen vesigenetiikan alalta. Tutkimuksen tekijöinä kaksi nuorta ja salskeaa huippututkijaa. Tutkimus oli valtavirrasta poiketen suoritettu tutkijoiden omalla henkilökohtaisella riskirahoituksella. (Soveltavan biotekniikan instituutti lahjoitti tutkijoille 50 litraa geenimuuntelematonta vettä) Fil. yo, cl- kemisti T. Korjamo tiivistää tutkimuksen tavoitteet seuraavasti: -Pienentää veden painoa nykyisestä 1000 grammasta 870,3 grammaan litralta kuljetuskustannusten säästämiseksi. Arvioimme tästä koituvat säästöjen maailman kansantaloudelle ylittävän 18,32 prosenttia. - Lisätä veden kosteutta tuntuvasti entiseen verrattuna. Tämän modifikaation vaikutukset tulevat olemaan tuntuvat maataloudelle ja agrikulturaaliselle elämäntavalle sellaisena kuin me sen tunnemme (mm. kosteusvoiteiden tarpeen väheneminen, huonekasvien kastelutarpeen väheneminen ja veden kosteuden puutteen väheneminen kuivilla alueilla.) - Veden pakkaskestävyyden parantaminen geenisiirroilla. Pakkaskestävämpi vesi parantaa Suomen kansantalouden tilaa arviolta noin 34,3 %. - Perustaa oma Sovelletun vesigenetiikan instituutti ja aloittaa uusien opiskelijoiden sisäänotto välittömästi. - Siirtää Helsingin kaupungin vesilaitos Kuopioon. Menetelmissään nuoret tutkijat hyödynsivät tutkimuksessaan vielä prototyyppiasteella olevia seuraavan sukupuolen geeninsiirtomenetelmiä. Menetelmät pohjautuivat vahvasti semikvantitatiiviseen ajatteluun ja kokeneiden tutkijoiden vankkaan ammattitaitoon. LuK, cl- kemisti J. Räty luettelee käytetyt menetelmät: - S. Cerevisiae- välitteinen geneettisen informaation stabiili ja instantti transfektio. - Etanoli-välitteinen kromosomiston gradienttimodifikaatio. - Zeta-aalto välitteinen sähkömagneettisen säteilyn disruptioon ja interferenssiin perustuva pistemutaatio. Vasemmalla tutkijoiden S.cerevisisae- välitteinen geeninsiirto käynnistymässä. Menetelmä: YTV:hen mitattiin 1,37 ml lähtömateriaalia ( Kontaminaatiovapaata vettä ) ja seuraavaksi tutkija valmistautui lisäämään kuivatun S. cerevisae ( Sunnuntai ) gluteus maximustuntemuksella. Lisättyään S. cerevisae:n, YTV:hen, aloitettiin nopea mutta kankea pyöritys vastapäivään ( Pohjoinen pallonpuolisko ). Tämän jälkeen näytteen tiheys määritettiin vaa alla ja pakkaskestävyyttä testattiin Rosenlew Vähävirtanenjäädytyskaappilaitteistolla 20 C:ssa. Geenisiirron stabiloimiseksi YTV:n välittömässä läheisyydessä (45,34 % ± 0,4 ) tuli olla pullollinen Virkonstabilanttia. Tutkija fil.yo, cl- kemisti T. Korjamo kertoo hieman uudesta etanolivälitteisestä kromosomiston gradienttimodifikaatiosta: Tämä geeninsiirtotekniikka ei ole maailmalla toistaiseksi kovinkaan laajalti tunnettu 1, mutta Suomessa ollaan jo pitkällä sen soveltamisessa. Ethanol transform vehicle ( Schott Duran, keskihylly ), myöh. ETV, toimi tässä menetelmässä stabiilina matriksina, joka vähensi 73 % kontaktia ulkomaailman transferenssia vastaan. Tutkija, LuK, cl-kemisti J. Räty lisää että, ETV:n amorfinen ja semistabiili pinta torjui myös 32,4 % haitallisia UV-B säteitä, jotka olisivat voineet aiheuttaa lisää haitallisia mutaatioita. 10

11 Tutkimus aloitettiin pipetoimalla (Biohit) 1 ml vierasgeenivapaata vettä ja lisäämällä vektorina (Veksna) toimivaa etanolia (EtOH- B) 2 ml ETV:hen. Seuraavaksi ETV:lle annettiin lämpöshokki haudutusteholla 100 W/ 1 min (Upo 1310 Tasalämpö- mikro sisältäen rotating- ominaisuuden), jonka jälkeen punnitsimme ETV:n vaa alla Kosteusmittaukset teimme Ultrospec sofistikoituneella mittauslaitteistolla, määrittäen DNA: pitoisuuden, joka korreloi suoraan ns. Moisture-ominaisuuksien kanssa 1.Pakkaskestävyysominaisuudet mittasimme Rosenlew Vähävirtanen- jäädytyskaappilaitteistolla 20 C:ssa. Yhteen ääneen, silminnähden innostuneet tutkijat huutavat kilpaa seuraavat lauseet : Uutena mullistavana menetelmänä meillä oli Zeta-aalto välitteinen sähkömagneettisen säteilyn disruptioon ja interferenssiin perustuva pistemutaatio, joka ei ole maailmalla toistaiseksi kovinkaan laajalti tunnettu 1, mutta Kuopiossa (Neulamäki) ollaan jo pitkällä sen soveltamisessa. Zetawave transform vehicle ( Schott Duran, alahylly ), myöh. ZTV, toimi tässä menetelmässä stabiilina matriksina, joka vähensi 71 % kontaktia ulkomaailman transferenssia vastaan. Sen amorfinen ja semistabiili pinta torjui myös 30,2 % haitallisia UV-B säteitä, jotka olisivat voineet aiheuttaa uusia haitallisia mutaatioita. Tutkija varustautui Zeta-aaltos Vahvistautasvehjasä : lla (Biohit, Lithuania) ja aloitti pistemutaatioiden luomisen veteen. Kohteenamme oli sekvenssin ATGC T:n muuttaminen A:ksi. Sivutuotteena saattoi syntyä tosin G- C tai A- T mutaatioita ja sekvenssin ATTCGGTGGGTGGGTATCGC muuttumista ATTCGCCGGCGATTAGCGCA:ksi (p= 0,0564 ja t>46,44 ± mittaustarkkuus. Tutkija keskittyi ja vapautti sisäisen Zeta-aaltonsa. Tässä tutkijaa auttoi suuresti zeta-aaltojen fyysinen ja transsendenttinen materialisoituma 2. Aaltojen seurauksena veden nukleotidiketjun difosfoesteri- backbonessa tapahtui em. haluttuja mutaatioita. Näiden muutosten seurauksena saimme aikaan fysikaalisia muutoksia. Myös tutkijoiden pankkitilillä tapahtui odottamattomia muutoksia. Molemmat tutkijat hehkuttavat tuloksia innoissaan: Tämänkin tutkimusraportin laadinnan aikana Helsingin kaupungin vesijohtolaitos eteni 2 µm Kuopiota kohden ja Sovelletun Vesigenetiikan Laitoksen perustamistoimenpiteiden jouduttamiseksi olemme panneet vireille Biokemian laitoksen kahtiajaon. Tuloksia tarkastellessa voidaan selvästi huomata vesigeneettisten modifikaatioiden positiivinen vaikutus tutkijoiden talouteen (36,22 %, julkaisematonta dataa, Merita oyj ja Osuuspankki). Lisäksi voidaan huomata selkeästi EGTmenetelmän edut muihin menetelmiin verrattuna. Etanolivälitteisessä geeninsiirrossa saavutimme selkeästi halutut tavoitteemme, veden tiheyden pieneneminen (14 %± mittaustarkkuuden neliö), pakkaskestävyyden lisääntyminen 16 C :seen, kosteuden lisääntyminen huomattavasti. Arvioimme tuoreissa laskelmissamme geenimanipuloitujen vesimolekyylien vaikutusta kansantalouteen ja saimme tuloksiksi 16,4 %. Tämä ei ole lainkaan niin hyvä kuin ryhmämme aluksi arvioima 32,4 %. Tämä luultavasti johtuu muiden menetelmien huonosta toimivuudesta. Myös piin arvon kausivaihtelut Helsingin pörssin HEX- indeksissä saattavat aiheuttaa globaalia kalkylointimatriksin fluktuaatiota. Varsinkin Zeta-aaltovälitteinen menetelmä osoittautui toisen ryhmän lupaavista tuloksista 1 huolimatta eräänlaiseksi tieteelliseksi ankaksi (vrt. kylmäfuusio). Kuitenkin uskomme vahvasti tulevaisuuden tuovan mukanaan myös tämänkin alan kehitystä. Suomen tiedepolitiikan olisi jo aika panostaa tieteellisten ankkojen tarhaukseen, jalostukseen ja kasvatukseen, jotta Suomen geopoliittinen kilpailukyky säilyisi kansainvälisessä kilpailussa. Hiivamenetelmä kohdisti DNA-modifikaationsa vääriin operoneihin. Onnistuimme lisäämään geneettisesti huomattavasti veden sameutta ja tunkkaista hajua. Näin kylmän sodan päätyttyä emme kuitenkaan usko kyseisillä ominaisuuksilla olevan merkitystä edes entisille Varsovan liiton jäsenmaille. Tahdomme esittää kiitoksemme kaikille meitä taloudellisesti (ei ketään) ja henkisesti (eräs alan professori Atte von) tukeneille. Hänen lohdulliset sanansa: Vesi on hyvää vain veneen alla loivat meihin uskoa tutkimuksemme synkimpinä hetkinä. (Tutkimus on-line: Lähteet: 1.Aproksimanoff KS ja Spekulatoff YK, Genetics and complete cdna- sequence of tapwater, The North-East Kirgiisian Journal of Applied Science for Illiterate Peasants, 49(1) 2-30, Catherine Zeta-Jones 3. Internet 11

12 Hevonpaskabingo Hevonpaskabingo Tässä ajankulua kemian luennoille. Peli toimii perinteisen bingon tapaan: Seuraa tarkasti luennoitsijan puheita. Hänen päästäessään ilmoille jonkin ruudukossa olevan sanan tai asian, ruksi kyseinen ruutu viereisestä taulukosta. Erikoisruudun Mauri saat rastittaa, kun näet Maurin. Saadessasi vaaka-, pysty- tai vinoriville 5 rastia, huuda kuuluvalla äänellä: Hevonpaskaa!!! Tällöin olet onnellinen voittaja. 12

13 The following is an actual question given on a University of Washington chemistry mid term. The answer was so profound that the professor shared it with colleagues, which is why we now have the pleasure of enjoying it as well. Bonus Question: Is Hell exothermic (gives off heat) or endothermic (absorbs heat)? Most of the students wrote proofs of their beliefs using Boyle s Law, (gas cools off when it expands and heats up when it is compressed) or some variant. One student, however, wrote the following: First, we need to know how the mass of Hell is changing in time. So we need to know the rate that souls are moving into Hell and the rate they are leaving. I think that we can safely assume that once a soul gets to Hell, it will not leave. Therefore, no souls are leaving. As for how many souls are entering Hell, lets look at the different religions that exist in the world today. Some of these religions state that if you are not a member of their religion, you will go to Hell. Since there are more than one of these religions and since people do not belong to more than one religion, we can project that all souls go to Hell. With birth and death rates as they are, we can expect the number of souls in Hell to increase exponentially. Now, we look at the rate of change of the volume in Hell because Boyle s Law states that in order for the temperature and pressure in Hell to stay the same, the volume of Hell has to expand as souls are added. This gives two possibilities: 1. If Hell is expanding at a slower rate than the rate at which souls enter Hell, then the temperature and pressure in Hell will increase until all Hell breaks loose. 2. Of course, if Hell is expanding at a rate faster than the increase of souls in Hell, then the temperature and pressure will drop until Hell freezes over. So which is it? If we accept the postulate given to me by Ms. Teresa Banyan during my Freshman year,...that it will be a cold day in Hell before I sleep with you., and take into account the fact that I still have not succeeded in having sexual relations with her, then, #2 cannot be true, and thus I am sure that Hell is exothermic and will not freeze. The student received the only A given. 13

14 MITÄ FUKSIVUODESTA JÄI MIELEEN? Päällimmäiseksi muistoksi ensimmäisestä päivästä ihka oikeana yliopisto-opiskelijana jäi kihelmöivä jännityksen tunne. Olo oli samaan aikaan innokas ja epävarma ja päässä risteili paitsi mielikuvia riehakkaasta opiskelijaelämästä myös kymmeniä epätietoisia ajatuksia tulevasta vuodesta..voisiko tänne ennalta tuntemattomaan savolaiskaupunkiin kotiutua?...entäpä opiskelun aloittamiseen liittyvät käytännön seikat?..ovatko uudet opiskelukaverit ihan mukiinmenevää porukkaa..?! Onneksi kyvykkäät tutorimme kaappasivat meidät tulokkaat siipiensä suojiin heti alkumetreillä. Tutorien vanavedessä kolusimme yliopiston kampusta Savilahden molemmin puolin ja selvitimme reitin omalle laitokselle.meitä keltanokkia perehdytettiin kärsivällisyydellä myös kirjaston toimintaan ja opastettiin tulkkaamaan lukujärjestyksen selittämättömiä kirjainlyhenteitä.luokkatilojen ja luentosalien koodien yhteys niiden sijaintiin jäi kyllä allekirjoittaneille ikuisiksi ajoiksi epäselväksi, mutta KYY-kalenterin kartan avulla selvittiiin!!pitkälle syksyyn jatkuneiden tutorkokoontumisten myötä meille aukenivat monet akateemiseen aherrukseen liittyvät mysteerit, kuten Tiukkisbileiden syvin olemus ja muut Kultina olemisen hienoudet. Kuin huomaamatta ropsahtivat ensimmäiset opintoviikot tilille ja puuhailu koeputkiloitten ja pipettien kanssa labran nurkissa marraskuun iltoina tuntui melkein luontevalta.kevätpuolellä harjaannuimme milteinpä mestareiksi mikroskoopin käytössä ja perehdyimme ihmisen anatomiaan.kemia puolella oli luvassa orgaaninen osuus, overlappaus ja karbokationin toisiintuminen olivat ainakin hetkellisesti hallussa..kuopio kalakukkoineen alkoi tuntua ihan mukavalta kaupungilta ja solukämppäänkin sopeutui hetkellisistä henkilökemioiden törmäilyistä huolimatta. Ehdottomia kohokohtia tapahtumarikkaan fuksivuoden varrelta olivat tietysti Akateeminen startti syyskuun piristyksenä sekä Puijon rinteiden 24 TL-lumileikit kevättalvella. Ei pidä myöskään unohtaa millilitrojen saalistuksen loppuhuipennusta eli ainejärjestön pikkujouluja..tai Turun excua..tai kemianpäiviä..tai sitä virallista hetkeä, kun puki uunituoreen Kultihaalaarin ekaa kertaa päälleen. Vuoden aikana tuli siis tehtyä muutakin kui eksyttyä luennolle väärään saliin tai piipahdettua uusimassa tenttiä.eräät löysivät itsensä jopa uuden hallituksen kokouksista kahvia hörppimästä!ja tulevaa lukukautta varten on taas monta jekkua takataskussa.. Juulia & Terhi I ve read about foreign policy and studied, I now know the number of continents. -George Wallace, 1968 presidential campaign 14

15 Savolainen työohje Ku savolaene avvoo pettuluukkusa, vastuu ottaa ja siirtyvä lujahuttaa kuulijoelle Kah, uot selevinnä tänne suakka. Varroohan käsilles las'tekka ja roeskase siihen kunnon tujjaas ehtoo höselii. Tae suat olla roeskasemattakii Vuan kun uot sen tehnynnä, lurraata semmonen napakka kurraas tiukkoo honnoo ja hullaata sekkaan jonkinmoenen kasa sinkkijä.eti melekosen sutjakkaasti jokkii riski möliskö, ja pyyvähän inehmoo nuuskasemmaan. Ja, vot, va jos ee kuulu mölisköstä kohtiisa halavatun äkinnäestä parkunnaa, niin suattaapa olla ettee oo aevan niin onnistunna tuo homma ku oel tarkotus. Va jos lähtöö mölisköstä ätäkät iänet, niin hilipaseha vähä kaavemmas, suattaa olla äkänen kuha tokenoo Rohvessorijen kaahuks toenennii kyhhääs No, va sittä pittää hommata esille par sattoo millijä tae enemmännii, jos vaaraasta torpasta uot lähtennä, tolujeeniä, tarpeeks mankeesiumia ja piälle veetöntä eetterijä ja laetahan ne issoon pulloon, jossa on jotikije. Laeta uuninpankolle porisemmaa pariks tuntija ja kää keettämässä tujakat kahveet. Va jos vielä kehtoot, tulehan takasi ja kää laskemassa siitä harmoosta pullosta, jossa o semmonen ulukomuanhuasteella präntätty varotus, kah niin, siitä otat hiilitijoksiitia kiinteenä ja kurraatat keitokset siihen. Lissee paljo naohija ja pyyvä sitä möliskötä, jos tuo vielä huasteloo kanssas, sekottelemmaa. Anna sekotella aekasa ja hörppee raahassa sumppija. Sitte uuttele veellä muutamisen kerran. Kah, sitte vuan suatat piälle höselii ja kahtelet ku sakkoo. Otaha taltee sakat, ja ruapase vähä puhtaammaks. Va, suattaapa sitte olla että oot suanunna aekaan pentseenihappova, va eepähän sitä tiijä, vaekka sieltä oes tullunna jottae muutakkii. Eepähää oo kukkaa vielä savolaesen huasteluilla mittää oppinna, va eepähä oo tyhmentynykkää Did you know? The short-term memory capacity for most people is between five and nine items or digits. This is one reason that phone numbers were kept to seven digits (not including area code). Synesthesia is a rare condition in which the senses are combined. Synesthetes see words, taste colors and shapes, and feel flavors. The simple act of walking requires the use of 200 muscles in the human body. 40 or so will lift your leg and move it forward. The African bushman lives in a quiet, remote environment and has no measurable hearing loss at age 60. The size of your foot is approximately the size of your forearm. The average adult has between 40 and 50 billion fat cells. The average adult stands 0.4 inch (1 cm) taller in the morning than in the evening, because the cartilage in the spine compresses during the day. The skeleton of an average 160 pound body weighs about 29 pounds. The soft mass of the adult brain is motionless. Though it consumes up to 25 percent of the blood s oxygen supply, it does not grow, divide, or contract. The sound of a snore (up to 69 decibels) can be almost as loud as the noise of a pneumatic drill (70 90 decibels). The strongest bone in the body, the thigh bone, is hollow. Ounce for ounce, it has a greater pressure tolerance and bearing strength than a rod of equivalent size in cast steel. The strongest muscle in the body is the tongue. The substance that human blood resembles most closely in terms of chemical composition in sea water. The swine flu vaccine in 1976 caused more death and illness than the disease it was intended to prevent. 15

16 TAPAHTUMAKALENTERI SYKSY 2000 Kulti-sanomat 2000 ELOKUU Fuksit aloittavat opintonsa Kultin tervetuliaisilta Tiukanlinnassa, OPM Kaupunkisuunnistus ja jatkot Ravintola Tähdessä SYYSKUU 5.9. Syksyn 2000 ensimmäiset yo-päivät Lukemalla 6.9. Kauppakadun korkkajaiset, järjestäjänä PSAKO 7.9. Yliopiston avajaiset klo Pooli varannut Tiukkiksen kastajaisiin Hyeenan kastajaiset; Tiukkis Hyvät Kuvat Sociuksen kastajaiset Tiukkiksessa Hyvät Kuvat AKATEEMINEN STARTTI!! Hyvät Kuvat LOKAKUU Hyeenan kostajaiset Tiukkiksessa Opiskelijalähetyksen tapahtuma Tiukkiksessa Yo-päivät Lukemalla Hyvät kuvat Hyvät kuvat Sociuksen vuosijuhla Tiukkiksessa Hyvät Kuvat MARRASKUU Hyvät kuvat Fortiksen vuosijuhlien jatkot Tiukkis Yo-päivät Lukemalla Hyvät kuvat Hyvät kuvat Kemian päivät 2000, syysexcu. Haalarit tähän mennessä! Ylioppilaskunnan vuosijuhla Hyvät kuvat Hyvät kuvat JOULUKUU FO-Kuopion vuosijuhlat Yo-päivät Lukemalla Itsenäisyyspäivän soihtukulkue Hyvät kuvat Kultin ja Kybbon pikkujoulut, kauden palkinnot Kultin joulumyyjäiset Muista myös: Kemistiliitto-info, Kybbo-saunailta, Kultin yleiskokous. Nyt Kultin jäsenille Puijonkadun Instrumentariumissa sandaalialennus! Kulti ry:n jäsenkortilla saa % alennnusta sandaaleista. Kultin jäsenyys siis kannattaa! Onhan sinulla jo jäsenkortti?

anna minun kertoa let me tell you

anna minun kertoa let me tell you anna minun kertoa let me tell you anna minun kertoa I OSA 1. Anna minun kertoa sinulle mitä oli. Tiedän että osaan. Kykenen siihen. Teen nyt niin. Minulla on oikeus. Sanani voivat olla puutteellisia mutta

Lisätiedot

Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)

Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition) Esko Jalkanen

Lisätiedot

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs

Lisätiedot

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31) Juha Kahkonen Click here if your download doesn"t start automatically On instrument costs

Lisätiedot

Capacity Utilization

Capacity Utilization Capacity Utilization Tim Schöneberg 28th November Agenda Introduction Fixed and variable input ressources Technical capacity utilization Price based capacity utilization measure Long run and short run

Lisätiedot

Information on Finnish Language Courses Spring Semester 2017 Jenni Laine

Information on Finnish Language Courses Spring Semester 2017 Jenni Laine Information on Finnish Language Courses Spring Semester 2017 Jenni Laine 4.1.2017 KIELIKESKUS LANGUAGE CENTRE Puhutko suomea? Do you speak Finnish? -Hei! -Moi! -Mitä kuuluu? -Kiitos, hyvää. -Entä sinulle?

Lisätiedot

Travel Getting Around

Travel Getting Around - Location Olen eksyksissä. Not knowing where you are Voisitko näyttää kartalta missä sen on? Asking for a specific location on a map Mistä täällä on? Asking for a specific...wc?...pankki / rahanvaihtopiste?...hotelli?...huoltoasema?...sairaala?...apteekki?...tavaratalo?...ruokakauppa?...bussipysäkki?

Lisätiedot

Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies

Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku Centre for Language and Communication Studies Information on Finnish Courses Autumn Semester 2017 Jenni Laine & Päivi Paukku 24.8.2017 Centre for Language and Communication Studies Puhutko suomea? -Hei! -Hei hei! -Moi! -Moi moi! -Terve! -Terve terve!

Lisätiedot

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi

Network to Get Work. Tehtäviä opiskelijoille Assignments for students. www.laurea.fi Network to Get Work Tehtäviä opiskelijoille Assignments for students www.laurea.fi Ohje henkilöstölle Instructions for Staff Seuraavassa on esitetty joukko tehtäviä, joista voit valita opiskelijaryhmällesi

Lisätiedot

Choose Finland-Helsinki Valitse Finland-Helsinki

Choose Finland-Helsinki Valitse Finland-Helsinki Write down the Temporary Application ID. If you do not manage to complete the form you can continue where you stopped with this ID no. Muista Temporary Application ID. Jos et onnistu täyttää lomake loppuun

Lisätiedot

MEETING PEOPLE COMMUNICATIVE QUESTIONS

MEETING PEOPLE COMMUNICATIVE QUESTIONS Tiistilän koulu English Grades 7-9 Heikki Raevaara MEETING PEOPLE COMMUNICATIVE QUESTIONS Meeting People Hello! Hi! Good morning! Good afternoon! How do you do? Nice to meet you. / Pleased to meet you.

Lisätiedot

Miksi Suomi on Suomi (Finnish Edition)

Miksi Suomi on Suomi (Finnish Edition) Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Click here if your download doesn"t start automatically Miksi Suomi on Suomi (Finnish Edition) Tommi Uschanov Miksi Suomi on Suomi (Finnish Edition)

Lisätiedot

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen

Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen The acquisition of science competencies using ICT real time experiments COMBLAB Uusia kokeellisia töitä opiskelijoiden tutkimustaitojen kehittämiseen Project N. 517587-LLP-2011-ES-COMENIUS-CMP This project

Lisätiedot

Information on preparing Presentation

Information on preparing Presentation Information on preparing Presentation Seminar on big data management Lecturer: Spring 2017 20.1.2017 1 Agenda Hints and tips on giving a good presentation Watch two videos and discussion 22.1.2017 2 Goals

Lisätiedot

Objektiharjoituksia. Harjoitus 2 Tässä on lyhyitä dialogeja. Pane objektit oikeaan muotoon. 1) - Vien... TÄMÄ KIRJE postiin.

Objektiharjoituksia. Harjoitus 2 Tässä on lyhyitä dialogeja. Pane objektit oikeaan muotoon. 1) - Vien... TÄMÄ KIRJE postiin. Objektiharjoituksia Harjoitus 1 Pane objekti oikeaan muotoon. 1. Ensin te kirjoitatte... TÄMÄ TESTI ja sitten annatte... PAPERI minulle. 2. Haluan... KUPPI - KAHVI. 3. Ostan... TUO MUSTA KENKÄ (mon.).

Lisätiedot

Efficiency change over time

Efficiency change over time Efficiency change over time Heikki Tikanmäki Optimointiopin seminaari 14.11.2007 Contents Introduction (11.1) Window analysis (11.2) Example, application, analysis Malmquist index (11.3) Dealing with panel

Lisätiedot

You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed

You can check above like this: Start->Control Panel->Programs->find if Microsoft Lync or Microsoft Lync Attendeed is listed Online Meeting Guest Online Meeting for Guest Participant Lync Attendee Installation Online kokous vierailevalle osallistujalle Lync Attendee Asennus www.ruukki.com Overview Before you can join to Ruukki

Lisätiedot

Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa. Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio

Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa. Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio Päättääkö opettaja ohjelmasta? Vai voisivatko opiskelijat itse suunnitella

Lisätiedot

Travel Accommodations

Travel Accommodations - Finding Mistä löytäisin? Asking for directions to accommodation...vuokrahuoneen?...hostellin?...hotellin?...b&b:n?...leirintäalueen? Minkä hintainen se on? Enquiring about the prices - Booking Onko teillä

Lisätiedot

Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa:

Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa: Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa: Koulutukseen ja Te-toimiston rooliin liittyviä kysymykset: 1. Olen yli 30-vuotias mutta

Lisätiedot

Counting quantities 1-3

Counting quantities 1-3 Counting quantities 1-3 Lukumäärien 1 3 laskeminen 1. Rastita Tick (X) (X) the kummassa box that has laatikossa more on balls enemmän in it. palloja. X 2. Rastita Tick (X) (X) the kummassa box that has

Lisätiedot

Contents. Kuinka monta jakson sanaa opit? Väritä tähdet. Hello. Numbers. Colours. 1. This is me. 2. Clothes. 3. Family. 4. Home. 5. Food. 6.

Contents. Kuinka monta jakson sanaa opit? Väritä tähdet. Hello. Numbers. Colours. 1. This is me. 2. Clothes. 3. Family. 4. Home. 5. Food. 6. Contents Kuinka monta jakson sanaa opit? Väritä tähdet. Hello Numbers Colours 1. This is me 2. Clothes 3. Family 4. Home 5. Food 6. I can 7. School 8. Hobbies 9. Animals 10. Moving around EXTRA Hello Piirrä

Lisätiedot

Kysyminen & vastaaminen (Asking & Answering)

Kysyminen & vastaaminen (Asking & Answering) Kysyminen & vastaaminen (Asking & Answering) Persoonapäätteet (personal endings/suffix) Jos A, O, U -vat. Jos ei -vät (If A, O, U -vat. If not -vät) Minä olen. Sinä olet. Hän on. (I am. You are. He/She

Lisätiedot

Results on the new polydrug use questions in the Finnish TDI data

Results on the new polydrug use questions in the Finnish TDI data Results on the new polydrug use questions in the Finnish TDI data Multi-drug use, polydrug use and problematic polydrug use Martta Forsell, Finnish Focal Point 28/09/2015 Martta Forsell 1 28/09/2015 Esityksen

Lisätiedot

Travel General. General - Essentials. General - Conversation. Asking for help. Asking if a person speaks English

Travel General. General - Essentials. General - Conversation. Asking for help. Asking if a person speaks English - Essentials Voisitko auttaa minua? Asking for help Puhutko englantia? Asking if a person speaks English Puhutteko _[kieltä]_? Asking if a person speaks a certain language En puhu _[kieltä]_. Clarifying

Lisätiedot

1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä

1.3Lohkorakenne muodostetaan käyttämällä a) puolipistettä b) aaltosulkeita c) BEGIN ja END lausekkeita d) sisennystä OULUN YLIOPISTO Tietojenkäsittelytieteiden laitos Johdatus ohjelmointiin 81122P (4 ov.) 30.5.2005 Ohjelmointikieli on Java. Tentissä saa olla materiaali mukana. Tenttitulokset julkaistaan aikaisintaan

Lisätiedot

Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition)

Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition) Nuku hyvin, pieni susi -????????????,?????????????????. Kaksikielinen satukirja (suomi - venäjä) (www.childrens-books-bilingual.com) (Finnish Edition) Click here if your download doesn"t start automatically

Lisätiedot

3. kappale (kolmas kappale) AI KA

3. kappale (kolmas kappale) AI KA 3. kappale (kolmas kappale) AI KA 3.1. Kellonajat: Mitä kello on? Kello on yksi. Kello on tasan yksi. Kello on kaksikymmentä minuuttia vaille kaksi. Kello on kymmenen minuuttia yli yksi. Kello on kymmenen

Lisätiedot

FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL

FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL FinFamily PostgreSQL 1 Sisällys / Contents FinFamily PostgreSQL... 1 1. Asenna PostgreSQL tietokanta / Install PostgreSQL database... 3 1.1. PostgreSQL tietokannasta / About the PostgreSQL database...

Lisätiedot

SELL Student Games kansainvälinen opiskelijaurheilutapahtuma

SELL Student Games kansainvälinen opiskelijaurheilutapahtuma SELL Student Games kansainvälinen opiskelijaurheilutapahtuma Painonnosto 13.5.2016 (kansallinen, CUP) Below in English Paikka: Nääshalli Näsijärvenkatu 8 33210 Tampere Alustava aikataulu: Punnitus 12:00-13:00

Lisätiedot

Twinning 2011 the real story UNCUTVERSION

Twinning 2011 the real story UNCUTVERSION Twinning 2011 the real story UNCUTVERSION 18. elokuuta kello 14.30 Hki- Vantaan kentällä alkoi tämän vuotinen Twinning vierailumme kaksoiskamariimme Stadeen. Lento lähti 17.30, mutta puheenjohtajamme Jarno

Lisätiedot

Laskennallisen fysiikan esimerkkejä avoimesta tutkimuksesta Esa Räsänen Fysiikan laitos, Tampereen teknillinen yliopisto

Laskennallisen fysiikan esimerkkejä avoimesta tutkimuksesta Esa Räsänen Fysiikan laitos, Tampereen teknillinen yliopisto Laskennallisen fysiikan esimerkkejä avoimesta tutkimuksesta Esa Räsänen Fysiikan laitos, Tampereen teknillinen yliopisto Julian Voss, Quantum man, 2006 (City of Moses Lake, Washington, USA) Kolme näkökulmaa

Lisätiedot

Täytyy-lause. Minun täytyy lukea kirja.

Täytyy-lause. Minun täytyy lukea kirja. Täytyy-lause Minun täytyy lukea kirja. Kenen? (-N) TÄYTYY / EI TARVITSE perusmuoto missä? mistä? mihin? milloin? miten? millä? Minun täytyy olla luokassa. Pojan täytyy tulla kotiin aikaisin. Heidän täytyy

Lisätiedot

Nimeni on. Tänään on (pvm). Kellonaika. Haastateltavana on. Haastattelu tapahtuu VSSHP:n lasten ja nuorten oikeuspsykiatrian tutkimusyksikössä.

Nimeni on. Tänään on (pvm). Kellonaika. Haastateltavana on. Haastattelu tapahtuu VSSHP:n lasten ja nuorten oikeuspsykiatrian tutkimusyksikössä. 1 Lapsen nimi: Ikä: Haastattelija: PVM: ALKUNAUHOITUS Nimeni on. Tänään on (pvm). Kellonaika. Haastateltavana on. Haastattelu tapahtuu VSSHP:n lasten ja nuorten oikeuspsykiatrian tutkimusyksikössä. OSA

Lisätiedot

VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto

VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto VAASAN YLIOPISTO Humanististen tieteiden kandidaatin tutkinto / Filosofian maisterin tutkinto Tämän viestinnän, nykysuomen ja englannin kandidaattiohjelman valintakokeen avulla Arvioidaan viestintävalmiuksia,

Lisätiedot

AJANILMAISUT AJAN ILMAISUT KOULUTUSKESKUS SALPAUS MODUULI 3

AJANILMAISUT AJAN ILMAISUT KOULUTUSKESKUS SALPAUS MODUULI 3 AJAN ILMAISUT AJAN ILMAISUT 1. PÄIVÄ, VIIKONPÄIVÄ 2. VUOROKAUDENAIKA 3. VIIKKO 4. KUUKAUSI 5. VUOSI 6. VUOSIKYMMEN, VUOSISATA, VUOSITUHAT 7. VUODENAIKA 8. JUHLAPÄIVÄT MILLOIN? 1. 2. 3. 4. maanantai, tiistai,

Lisätiedot

make and make and make ThinkMath 2017

make and make and make ThinkMath 2017 Adding quantities Lukumäärienup yhdistäminen. Laske yhteensä?. Countkuinka howmonta manypalloja ballson there are altogether. and ja make and make and ja make on and ja make ThinkMath 7 on ja on on Vaihdannaisuus

Lisätiedot

Alueellinen yhteistoiminta

Alueellinen yhteistoiminta Alueellinen yhteistoiminta Kokemuksia alueellisesta toiminnasta Tavoitteet ja hyödyt Perusterveydenhuollon yksikön näkökulmasta Matti Rekiaro Ylilääkäri Perusterveydenhuollon ja terveyden edistämisen yksikkö

Lisätiedot

Oma sininen meresi (Finnish Edition)

Oma sininen meresi (Finnish Edition) Oma sininen meresi (Finnish Edition) Hannu Pirilä Click here if your download doesn"t start automatically Oma sininen meresi (Finnish Edition) Hannu Pirilä Oma sininen meresi (Finnish Edition) Hannu Pirilä

Lisätiedot

ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana

ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin. Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana ECVETin soveltuvuus suomalaisiin tutkinnon perusteisiin Case:Yrittäjyyskurssi matkailualan opiskelijoille englantilaisen opettajan toteuttamana Taustaa KAO mukana FINECVET-hankeessa, jossa pilotoimme ECVETiä

Lisätiedot

Exercise 1. (session: )

Exercise 1. (session: ) EEN-E3001, FUNDAMENTALS IN INDUSTRIAL ENERGY ENGINEERING Exercise 1 (session: 24.1.2017) Problem 3 will be graded. The deadline for the return is on 31.1. at 12:00 am (before the exercise session). You

Lisätiedot

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland Anne Mari Juppo, Nina Katajavuori University of Helsinki Faculty of Pharmacy 23.7.2012 1 Background Pedagogic research

Lisätiedot

Lukio.fi. Laura Simik Pääsihteeri Suomen Lukiolaisten Liitto

Lukio.fi. Laura Simik Pääsihteeri Suomen Lukiolaisten Liitto Lukio.fi Laura Simik Pääsihteeri Suomen Lukiolaisten Liitto Liikkeelle lähtö Ajatus1 Tavaa o n g e l m a Lukio.fi = commodore64 Sivusto yhtä aikansa elänyt ja viihdyttävä kuin otsapermis tai NKOTB Julkaisujärjestelmä

Lisätiedot

Junaelokuva 6 (kuvausversio) 14.8.2011. Kirjoittanut: Ismo Kiesiläinen. sekä Leena Kuusisto. Alkuperäisidea: Julieta Lehto

Junaelokuva 6 (kuvausversio) 14.8.2011. Kirjoittanut: Ismo Kiesiläinen. sekä Leena Kuusisto. Alkuperäisidea: Julieta Lehto Junaelokuva 6 (kuvausversio) 14.8.2011 Kirjoittanut: Ismo Kiesiläinen sekä Leena Kuusisto Alkuperäisidea: Julieta Lehto 01 INT. RAVINTOLAVAUNU - ALKUILTA Tyttö istuu junan ravintolavaunussa pienen baaripöydän

Lisätiedot

HELBUS CONDUCT. Welcome to HELBUS. We are happy you are here!

HELBUS CONDUCT. Welcome to HELBUS. We are happy you are here! HELBUS CONDUCT Welcome to HELBUS. We are happy you are here! Our mission is to offer young people a path to a career in international business. Let us be your steppingstone for global opportunities! Explore

Lisätiedot

Salasanan vaihto uuteen / How to change password

Salasanan vaihto uuteen / How to change password Salasanan vaihto uuteen / How to change password Sisällys Salasanakäytäntö / Password policy... 2 Salasanan vaihto verkkosivulla / Change password on website... 3 Salasanan vaihto matkapuhelimella / Change

Lisätiedot

Matkustaminen Yleistä

Matkustaminen Yleistä - Olennaiset Voisitko auttaa minua? Avun pyytäminen Puhutko englantia? Tiedustelu henkilöltä puhuuko hän englantia Can you help me, please? Do you speak English? Puhutteko _[kieltä]_? Tiedustelu henkilöltä

Lisätiedot

Matkustaminen Yleistä

Matkustaminen Yleistä - Olennaiset Can you help me, please? Avun pyytäminen Do you speak English? Tiedustelu henkilöltä puhuuko hän englantia Voisitko auttaa minua? Puhutko englantia? Do you speak _[language]_? Tiedustelu henkilöltä

Lisätiedot

Matkustaminen Yleistä

Matkustaminen Yleistä - Olennaiset Voisitko auttaa minua? Avun pyytäminen Puhutko englantia? Tiedustelu henkilöltä puhuuko hän englantia Can you help me, please? Do you speak English? Puhutteko _[kieltä]_? Tiedustelu henkilöltä

Lisätiedot

Matematiikka ja tilastotiede

Matematiikka ja tilastotiede Matematiikka ja tilastotiede Turun yliopistossa Lauri Heinonen lakahei@utu.fi 21.12 Laitilan lukiolla Minä Kirjoitin keväällä 2015 Laitilan lukiosta Matematiikan ja tilastotieteen koulutusohjelma Luen

Lisätiedot

Ohjelmointikielet ja -paradigmat 5op. Markus Norrena

Ohjelmointikielet ja -paradigmat 5op. Markus Norrena Ohjelmointikielet ja -paradigmat 5op Markus Norrena Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Kotitehtävä 6, toteuttakaa alla olevan luokka ja attribuutit (muuttujat) Huom!

Lisätiedot

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015

TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 1 TIETEEN PÄIVÄT OULUSSA 1.-2.9.2015 Oulun Yliopisto / Tieteen päivät 2015 2 TIETEEN PÄIVÄT Järjestetään Oulussa osana yliopiston avajaisviikon ohjelmaa Tieteen päivät järjestetään saman konseptin mukaisesti

Lisätiedot

Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ

Biojätteen keruu QuattroSelect - monilokerojärjestelmällä. 21.10.2015 Tiila Korhonen SUEZ Biojätteen keruu QuattroSelect - monilokerojärjestelmällä 21.10.2015 Tiila Korhonen SUEZ Agenda 1 SITA Suomi on SUEZ 2 QS, mikä se on? 3 QS maailmalla 4 QS Suomessa 5 QS Vaasassa SITA Suomi Oy ja kaikki

Lisätiedot

Pitäisi olla semmosta lämpöö VÄLITTÄVÄN OPETTAJAN 10 TEESIÄ

Pitäisi olla semmosta lämpöö VÄLITTÄVÄN OPETTAJAN 10 TEESIÄ KOULU TURVAPAIKKANA? oppilaan psyykkistä hyvinvointia edistämässä Jyväskylä 5.11.2015 Pitäisi olla semmosta lämpöö VÄLITTÄVÄN OPETTAJAN 10 TEESIÄ Tanja Äärelä KT, yliopistonlehtori, Lapin yliopisto erityisluokanopettaja,

Lisätiedot

Vallataan varainhankinta. Salla Saarinen 24.2.2014

Vallataan varainhankinta. Salla Saarinen 24.2.2014 Vallataan varainhankinta Salla Saarinen 24.2.2014 1 Salla Saarinen Varainhankinnan Kampanjoinnin Markkinoinnin Sparrausta * Koulutusta * Suunnittelua * Toteutusta Lisää tunnetta ja tulosta järjestökentälle

Lisätiedot

The CCR Model and Production Correspondence

The CCR Model and Production Correspondence The CCR Model and Production Correspondence Tim Schöneberg The 19th of September Agenda Introduction Definitions Production Possiblity Set CCR Model and the Dual Problem Input excesses and output shortfalls

Lisätiedot

MRI-sovellukset. Ryhmän 6 LH:t (8.22 & 9.25)

MRI-sovellukset. Ryhmän 6 LH:t (8.22 & 9.25) MRI-sovellukset Ryhmän 6 LH:t (8.22 & 9.25) Ex. 8.22 Ex. 8.22 a) What kind of image artifact is present in image (b) Answer: The artifact in the image is aliasing artifact (phase aliasing) b) How did Joe

Lisätiedot

Herään aikaisin aamulla herätyskellon pirinään. En jaksanut millään lähteä kouluun, mutta oli aivan pakko. En syönyt edes aamupalaa koska en olisi

Herään aikaisin aamulla herätyskellon pirinään. En jaksanut millään lähteä kouluun, mutta oli aivan pakko. En syönyt edes aamupalaa koska en olisi Akuliinan tarina Herään aikaisin aamulla herätyskellon pirinään. En jaksanut millään lähteä kouluun, mutta oli aivan pakko. En syönyt edes aamupalaa koska en olisi muuten kerennyt kouluun. Oli matikan

Lisätiedot

A: What s wrong? A aloittaa. Kuuntele ja auta tarvittaessa. Parisi auttaa tarvittaessa. Sinä aloitat. Sano vuorosanasi englanniksi.

A: What s wrong? A aloittaa. Kuuntele ja auta tarvittaessa. Parisi auttaa tarvittaessa. Sinä aloitat. Sano vuorosanasi englanniksi. High five! 4 Chapter 4 Down by the river LIITE 6a Työpistetyöskentely Piste 1 1 Valitse parisi kanssa kappaleiden 1 3 teksteistä yksi ja lukekaa se ääneen englanniksi 2 Tee alla oleva tehtävä parisi kanssa

Lisätiedot

AYYE 9/ HOUSING POLICY

AYYE 9/ HOUSING POLICY AYYE 9/12 2.10.2012 HOUSING POLICY Mission for AYY Housing? What do we want to achieve by renting apartments? 1) How many apartments do we need? 2) What kind of apartments do we need? 3) To whom do we

Lisätiedot

EVALUATION FOR THE ERASMUS+-PROJECT, STUDENTSE

EVALUATION FOR THE ERASMUS+-PROJECT, STUDENTSE #1 Aloitettu: 6. marraskuuta 2015 9:03:38 Muokattu viimeksi: 6. marraskuuta 2015 9:05:26 Käytetty aika: 00:01:47 IP-osoite: 83.245.241.86 K1: Nationality Finnish K2: The program of the week has been very

Lisätiedot

LET S GO! 5 KOEALUE 4-6 Nähnyt:

LET S GO! 5 KOEALUE 4-6 Nähnyt: 1 LET S GO! 5 KOEALUE 4-6 Nähnyt: On jälleen tullut aika testata osaamisesi. Koekappaleina ovat kappaleet 7-9. Muista LUKEA KAPPALEITA ÄÄNEEN useaan otteeseen ja opetella erityisen hyvin KUVASANASTOT ja

Lisätiedot

Käyttöliittymät II. Käyttöliittymät I Kertaus peruskurssilta. Keskeisin kälikurssilla opittu asia?

Käyttöliittymät II. Käyttöliittymät I Kertaus peruskurssilta. Keskeisin kälikurssilla opittu asia? Käyttöliittymät II Sari A. Laakso Käyttöliittymät I Kertaus peruskurssilta Keskeisin kälikurssilla opittu asia? 1 Käyttöliittymät II Kurssin sisältö Käli I Käyttötilanteita Käli II Käyttötilanteet selvitetään

Lisätiedot

Työharjoittelu Saksassa - Kleve 19.4.2014 Työharjoittelu paikka - Kleidorp Ajankohta 1.3 11.4.2014

Työharjoittelu Saksassa - Kleve 19.4.2014 Työharjoittelu paikka - Kleidorp Ajankohta 1.3 11.4.2014 Stephar Stephar Matkaraportti Työharjoittelu Saksassa - Kleve 19.4.2014 Työharjoittelu paikka - Kleidorp Ajankohta 1.3 11.4.2014 Tässä matkaraportista yritän kertoa vähän, että miten minulla meni lentomatka,

Lisätiedot

9.1. Mikä sinulla on?

9.1. Mikä sinulla on? 9.kappale (yhdeksäs kappale) 9.1. Mikä sinulla on? Minulla on yskä. Minulla on nuha. Minulla on kuumetta. Minulla on kurkku kipeä. Minulla on vesirokko. Minulla on flunssa. Minulla on vatsa kipeä. Minulla

Lisätiedot

Tervetuloa! Mä asun D-rapussa. Mun asunto on sellainen poikamiesboksi.

Tervetuloa! Mä asun D-rapussa. Mun asunto on sellainen poikamiesboksi. Juhan naapuri Juha tulee töistä kotiin puoli kahdelta. Pihalla on tumma mies pienen tytön kanssa. Tyttö leikkii hiekkalaatikolla. Mies istuu penkillä ja lukee sanomalehteä. Terve! Moi! Sä oot varmaan uusi

Lisätiedot

SUOKI TOIMINTA PASSI

SUOKI TOIMINTA PASSI I K O SU M I TO A T IN A P I SS nimi: Näitä taitoja, joita harjoittelet tässä passissa, sinä tarvitset: A Työharjoittelussa B Vapaa-aikana C Koulussa Nämä taidot kehittyvät, kun teet tehtävät huolellisesti:

Lisätiedot

MITEN TEET AIKAAN LIITTYVIÄ KYSYMYKSIÄ JA MITEN VASTAAT NIIHIN?

MITEN TEET AIKAAN LIITTYVIÄ KYSYMYKSIÄ JA MITEN VASTAAT NIIHIN? MITEN TEET AIKAAN LIITTYVIÄ KYSYMYKSIÄ JA MITEN VASTAAT NIIHIN? 1. MILLOIN? KOSKA? 2. MIHIN AIKAAN? 3. MINÄ PÄIVÄNÄ? 4. MILLÄ VIIKOLLA? 5. MISSÄ KUUSSA? 6. MINÄ VUONNA? 7. MILLÄ VUOSIKYMMENELLÄ? 8. MILLÄ

Lisätiedot

Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition)

Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Click here if your download doesn"t start automatically Uusi Ajatus Löytyy Luonnosta 3 (Finnish Edition) Esko Jalkanen Uusi Ajatus Löytyy

Lisätiedot

SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko.

SUBSTANTIIVIT 1/6. juttu. joukkue. vaali. kaupunki. syy. alku. kokous. asukas. tapaus. kysymys. lapsi. kauppa. pankki. miljoona. keskiviikko. SUBSTANTIIVIT 1/6 juttu joukkue vaali kaupunki syy alku kokous asukas tapaus kysymys lapsi kauppa pankki miljoona keskiviikko käsi loppu pelaaja voitto pääministeri päivä tutkimus äiti kirja SUBSTANTIIVIT

Lisätiedot

Kestävä kehitys - Lupa toimia eri tavalla. 2013 20.9. Naantali Anssi Tuulenmäki, Yli-innovaatioaktivisti

Kestävä kehitys - Lupa toimia eri tavalla. 2013 20.9. Naantali Anssi Tuulenmäki, Yli-innovaatioaktivisti Kestävä kehitys - Lupa toimia eri tavalla 2013 20.9. Naantali Anssi Tuulenmäki, Yli-innovaatioaktivisti Tutkimuspäällikkö vai Yli-innovaatioaktivisti? Vastaanottovirkailija vai First Impression Manager?

Lisätiedot

The Viking Battle - Part Version: Finnish

The Viking Battle - Part Version: Finnish The Viking Battle - Part 1 015 Version: Finnish Tehtävä 1 Olkoon kokonaisluku, ja olkoon A n joukko A n = { n k k Z, 0 k < n}. Selvitä suurin kokonaisluku M n, jota ei voi kirjoittaa yhden tai useamman

Lisätiedot

o l l a käydä 13.1. Samir kertoo:

o l l a käydä 13.1. Samir kertoo: 13. kappale (kolmastoista kappale) SAMI RI N KOULUVII KKO 13.1. Samir kertoo: Kävin eilen Mohamedin luona. Hän oli taas sairas. Hänellä oli flunssa. Minä kerroin Mohamedille, että myös minulla on pää kipeä.

Lisätiedot

Gap-filling methods for CH 4 data

Gap-filling methods for CH 4 data Gap-filling methods for CH 4 data Sigrid Dengel University of Helsinki Outline - Ecosystems known for CH 4 emissions; - Why is gap-filling of CH 4 data not as easy and straight forward as CO 2 ; - Gap-filling

Lisätiedot

Expression of interest

Expression of interest Expression of interest Avoin hakemus tohtorikoulutettavaksi käytäntö Miksi? Dear Ms. Terhi virkki-hatakka I am writing to introduce myself as a volunteer who have the eagerness to study in your university.

Lisätiedot

Aakkoset Aa Ii Uu Ss Nn Ee Oo Ll Rr Mm Tt Ää Pp Kk Jj Vv Hh Yy Öö Dd Gg Bb Ff Cc Ww Xx Zz Qq Åå Numerot 0 1 2 3 4 5 6 7 8 9 10 Kuka on...? (adjektiivit) 1. 2. 3. 4. 5. 6. 7. 8. Kenellä on...? (omistaminen)

Lisätiedot

Katsaus museoiden kokoelmahallintajärjestelmiin

Katsaus museoiden kokoelmahallintajärjestelmiin Katsaus museoiden kokoelmahallintajärjestelmiin Tiedonhallintakeskus Vesa Hongisto 11.2.2009 In his book Smart Selection and Management of Association Computer Systems, Thomas J. Orlowski states: Think

Lisätiedot

VERBI ILMAISEE MYÖNTEISYYTTÄ JA KIELTEISYYTTÄ

VERBI ILMAISEE MYÖNTEISYYTTÄ JA KIELTEISYYTTÄ VERBI ILMAISEE MYÖNTEISYYTTÄ JA KIELTEISYYTTÄ EI taipuu tekijän mukaan + VERBI NUKU/N EI NUKU (minä) EN NUKU (sinä) ET NUKU hän EI NUKU (me) EMME NUKU (te) ETTE NUKU he EIVÄT NUKU (tekijänä joku, jota

Lisätiedot

Travel Health. Health - Emergency. Health - At the Doctor's. Minun tarvitsee päästä sairaalaan Asking to be brought to the hospital. Voin pahoin.

Travel Health. Health - Emergency. Health - At the Doctor's. Minun tarvitsee päästä sairaalaan Asking to be brought to the hospital. Voin pahoin. - Emergency Minun tarvitsee päästä sairaalaan Asking to be brought to the hospital Voin pahoin. Tarvitsen lääkäriä välittömästi! Asking for immediate medical care Apua! Shouting for immediate medical attention

Lisätiedot

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa?

Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Korkeakoulujen tietohallinto ja tutkimus: kumpi ohjaa kumpaa? Kerro meille datastasi työpaja 10.4.2013 Antti Auer Tietohallintopäällikkö Jyväskylän yliopisto Strateginen kehittäminen Johtamista, tutkimushallintoa

Lisätiedot

Työssäoppimassa Tanskassa

Työssäoppimassa Tanskassa Työssäoppimassa Tanskassa Taustatietoja kohteesta: Herning- kaupunki sijaitsee Tanskassa Keski- Jyllannissa. Herningissä asukkaita on noin. 45 890. Soglimt koostuu yhteensä 50 hoitopaikasta. Soglimtissa

Lisätiedot

HOITAJAN ROOLI TEKNOLOGIAVÄLITTEISESSÄ POTILASOHJAUKSESSA VÄITÖSKIRJATUTKIJA JENNI HUHTASALO

HOITAJAN ROOLI TEKNOLOGIAVÄLITTEISESSÄ POTILASOHJAUKSESSA VÄITÖSKIRJATUTKIJA JENNI HUHTASALO HOITAJAN ROOLI TEKNOLOGIAVÄLITTEISESSÄ POTILASOHJAUKSESSA VÄITÖSKIRJATUTKIJA JENNI HUHTASALO Tutkimusintressit Asiantuntijuus ja teknologia: Hoitajan rooli teknologiavälitteisessä potilasohjauksessa Opettajan

Lisätiedot

Kielenkäytön näkökulma oppimisvuorovaikutukseen

Kielenkäytön näkökulma oppimisvuorovaikutukseen Kielenkäytön näkökulma oppimisvuorovaikutukseen Tarja Nikula Soveltavan kielentutkimuksen keskus tarja.nikula@jyu.fi Kiinnostuksen kohteena Luokkahuonevuorovaikutus vieraalla kielellä englannin kielen

Lisätiedot

Yksi elämä -hanke. Kuluttajakysely Yksi elämä -hankkeesta Marraskuu 2016

Yksi elämä -hanke. Kuluttajakysely Yksi elämä -hankkeesta Marraskuu 2016 Yksi elämä -hanke Kuluttajakysely Yksi elämä -hankkeesta Marraskuu 2016 Johdanto Tämän kyselytutkimuksen Yksi elämä hankkeelle on toteuttanut YouGov Finland Tiedot kerättiin web-kyselynä 2.11. 6.11.2016

Lisätiedot

LAUSEEN KIRJOITTAMINEN. Peruslause. aamu - minä - syödä muro - ja - juoda - kuuma kahvi Aamulla minä syön muroja ja juon kuumaa kahvia.

LAUSEEN KIRJOITTAMINEN. Peruslause. aamu - minä - syödä muro - ja - juoda - kuuma kahvi Aamulla minä syön muroja ja juon kuumaa kahvia. LAUSEEN KIRJOITTAMINEN Peruslause aamu - minä - syödä muro - ja - juoda - kuuma kahvi Aamulla minä syön muroja ja juon kuumaa kahvia. minä - täti - ja - setä - asua Kemi Valtakatu Minun täti ja setä asuvat

Lisätiedot

Yleinen kielitutkinto, keskitaso, harjoituksia /

Yleinen kielitutkinto, keskitaso, harjoituksia / RUOKA LÄMMITTELY 1. Mitä teet aamulla ensimmäiseksi? Entä sen jälkeen? 2. Mihin aikaan syöt yleensä aamupalaa / lounasta / päivällistä / iltapalaa? 3. Mitä teet iltapäivällä? 4. Mitä sinä syöt usein? 5.

Lisätiedot

LAPSEN HAASTATTELULOMAKE (alle 10-vuotiaalle)

LAPSEN HAASTATTELULOMAKE (alle 10-vuotiaalle) LAPSEN HAASTATTELULOMAKE (alle 10-vuotiaalle) Lapsi Haastattelija Päivä ja paikka 1 LAPSI JA HÄNEN PERHEENSÄ Vanhempasi ovat varmaankin kertoneet Sinulle syyn siihen, miksi olen halunnut tavata Sinua.

Lisätiedot

MOOC toiveita ja pelkoja. Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto

MOOC toiveita ja pelkoja. Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto MOOC toiveita ja pelkoja Jaakko Kurhila opintoesimies tietojenkäsittelytieteen laitos Helsingin yliopisto Messukeskus 2.12.2013 massive open online course 1980 jokaisella on pilvi taskussa 1869 2013 Aika

Lisätiedot

Inessiivi, elatiivi, illativi, adessiivi, ablatiivi vai allatiivi?

Inessiivi, elatiivi, illativi, adessiivi, ablatiivi vai allatiivi? KERTAUSTEHTÄVIÄ WS 05/06 A Inessiivi, elatiivi, illativi, adessiivi, ablatiivi vai allatiivi? 1. Juha käy aina lauantaina (TORI). 2. Juna saapuu (ASEMA). 3. Olemme (HELSINKI). 4. (MIKÄ KATU) te asutte?

Lisätiedot

Mitä Master Class:ssa opittiin?

Mitä Master Class:ssa opittiin? Mitä Master Class:ssa opittiin? Tutkimuskoordinaattori Kaisa Korhonen-Kurki, Helsingin yliopisto Tutkija Katriina Soini, Helsingin yliopisto Yliopistopedagogi Henna Asikainen, Helsingin yliopisto Tausta

Lisätiedot

Vertaispalaute. Vertaispalaute, /9

Vertaispalaute. Vertaispalaute, /9 Vertaispalaute Vertaispalaute, 18.3.2014 1/9 Mistä on kyse? opiskelijat antavat palautetta toistensa töistä palaute ei vaikuta arvosanaan (palautteen antaminen voi vaikuttaa) opiskelija on työskennellyt

Lisätiedot

TEE OIKEIN. Minun naapuri on (rikas) kuin minä. Hänellä on (iso) asunto ja (hieno) auto.

TEE OIKEIN. Minun naapuri on (rikas) kuin minä. Hänellä on (iso) asunto ja (hieno) auto. TEE OIKEIN Kumpi on (suuri), Rovaniemi vai Ylitornio? Tämä talo on paljon (valoisa) kuin teidän vanha talo. Pusero on (halpa) kuin takki. Tämä tehtävä on vähän (helppo) kuin tuo. Minä olen (pitkä) kuin

Lisätiedot

VERBI + TOINEN VERBI = VERBIKETJU

VERBI + TOINEN VERBI = VERBIKETJU VERBI + TOINEN VERBI = VERBIKETJU 1. Apuverbi vaatii seuraavan verbin määrämuotoon. Lisää verbi luettelosta ja taivuta se oikeaan muotoon. Voimme Me haluamme Uskallatteko te? Gurli-täti ei tahdo Et kai

Lisätiedot

Guidebook for Multicultural TUT Users

Guidebook for Multicultural TUT Users 1 Guidebook for Multicultural TUT Users WORKPLACE PIRKANMAA-hankkeen KESKUSTELUTILAISUUS 16.12.2010 Hyvää käytäntöä kehittämässä - vuorovaikutusopas kansainvälisille opiskelijoille TTY Teknis-taloudellinen

Lisätiedot

6. Vastaa kysymyksiin Onko sinulla isoveli? Oletko sinä lyhyt? Minkä väriset hiukset sinulla on? Onko sinulla siniset silmät? Oletko nyt iloinen?

6. Vastaa kysymyksiin Onko sinulla isoveli? Oletko sinä lyhyt? Minkä väriset hiukset sinulla on? Onko sinulla siniset silmät? Oletko nyt iloinen? 5. Vastaa kysymyksiin (kpl1) Onko sinulla sisaruksia? Asuuko sinun perhe kaukana? Asutko sinä keskustan lähellä? Mitä sinä teet viikonloppuna? Oletko sinä viikonloppuna Lahdessa? Käytkö sinä usein ystävän

Lisätiedot

Uni ja lepo töissä sallittua vai kiellettyä?

Uni ja lepo töissä sallittua vai kiellettyä? Uni ja lepo töissä sallittua vai kiellettyä? 21.8.2014 Professori, KTT, Anu Valtonen Lapin yliopisto, Yhteiskuntatieteiden tiedekunta Tausta Tutkimusprojekti New Sleep Order Mitä on tapahtumassa unen ja

Lisätiedot

Matkustaminen Majoittuminen

Matkustaminen Majoittuminen - Majoituspaikan löytäminen Where can I find? Ohjeiden kysyminen majoituspaikan löytämiseksi Where can I find?... a room to rent?... a room to rent?... a hostel?... a hostel?... a hotel?... a hotel?...

Lisätiedot

Matkustaminen Majoittuminen

Matkustaminen Majoittuminen - Majoituspaikan löytäminen Where can I find? Ohjeiden kysyminen majoituspaikan löytämiseksi... a room to rent?... a hostel?... a hotel?... a bed and breakfast?... a camping site? What are the prices like

Lisätiedot

Digitalisoituminen, verkottuminen ja koulutuksen tulevaisuus. Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu

Digitalisoituminen, verkottuminen ja koulutuksen tulevaisuus. Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu Digitalisoituminen, verkottuminen ja koulutuksen tulevaisuus Teemu Leinonen teemu.leinonen@taik.fi Medialaboratorio Taideteollinen korkeakoulu The future is already here - it is just unevenly distributed.

Lisätiedot