Efficient regeneration system and Agrobacteriummediated transformation of Vetiver. PT 1

Samankaltaiset tiedostot
Supporting Information for

Plasmid Name: pmm290. Aliases: none known. Length: bp. Constructed by: Mike Moser/Cristina Swanson. Last updated: 17 August 2009

tgg agg Supplementary Figure S1.

Capacity Utilization

ProAgria. Opportunities For Success

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

anna minun kertoa let me tell you

Rikasta Pohjoista 2019 Uudistuva teollisuus Teollisten innovaatioiden tulevaisuus

Technische Daten Technical data Tekniset tiedot Hawker perfect plus

Green Growth Sessio - Millaisilla kansainvälistymismalleilla kasvumarkkinoille?

Fighting diffuse nutrient load: Multifunctional water management concept in natural reed beds

Building Information Model (BIM) promoting safety in the construction site process. SafetyBIM research project 10/2007 2/2009. (TurvaBIM in Finnish)

Experimental Identification and Computational Characterization of a Novel. Extracellular Metalloproteinase Produced by Clostridium sordellii

Matchsaver on jalkapallokentän peitejärjestelmiin erikoistunut yritys ja sijaitsee Englannissa North Yorkshiren maakunnassa.!

On instrument costs in decentralized macroeconomic decision making (Helsingin Kauppakorkeakoulun julkaisuja ; D-31)

SUORITUSTASOILMOITUS

Supporting information

The CCR Model and Production Correspondence

Stormwater filtration unit

Supplementary information: Biocatalysis on the surface of Escherichia coli: melanin pigmentation of the cell. exterior

Gap-filling methods for CH 4 data

FROM VISION TO CRITERIA: PLANNING SUSTAINABLE TOURISM DESTINATIONS Case Ylläs Lapland

Efficiency change over time

Tekes the Finnish Funding Agency for Technology and Innovation. Copyright Tekes

Indoor Environment

Uusi Ajatus Löytyy Luonnosta 4 (käsikirja) (Finnish Edition)

Lapin Rovaniemen moduuli 2 verkko-opiskelijoiden kysymyksiä tetoimiston virkailijoiden tapaamiseen AC-huoneessa:

Research plan for masters thesis in forest sciences. The PELLETime 2009 Symposium Mervi Juntunen

Other approaches to restrict multipliers

Ostamisen muutos muutti myynnin. Technopolis Business Breakfast

Exercise 1. (session: )

Katri Vala heating and cooling plant - Eco-efficient production of district heating and cooling

Data quality points. ICAR, Berlin,

Functional Genomics & Proteomics

Arkkitehtuuritietoisku. eli mitä aina olet halunnut tietää arkkitehtuureista, muttet ole uskaltanut kysyä

Strain or plasmid Description a Reference or source b. 168 trpc2 Laboratory. 1A780 trpc2 sigb::spc BGSC

Flexbright Oy Embedded software/hardware engineer

ENE-C2001 Käytännön energiatekniikkaa. Aloitustapaaminen Osa II: Projekti- ja tiimityö

TietoEnator Pilot. Ari Hirvonen. TietoEnator Oyj. Senior Consultant, Ph. D. (Economics) presentation TietoEnator 2003 Page 1

THE NEW SHELTER PROJECT. PRO ANIMALS ROMANIA & PRO ANIMALS FINLAND The project continues as soon as funds are collected to do so

TÄUBLER OY. Vuorimiehenkatu Helsinki Finland. Puh: Fax:

Improving advisory services through technology. Challenges for agricultural advisory after 2020 Jussi Juhola Warsaw,

Expression of interest

Innovative and responsible public procurement Urban Agenda kumppanuusryhmä. public-procurement

BRUTTO PINTA- ALA (M 2 ) KEHYKSEN MATERIAAL I. EA-HP-1500/47-18 Super heat ALUMIINI 1, , *1680*110 59

Kysymys 5 Compared to the workload, the number of credits awarded was (1 credits equals 27 working hours): (4)

Älykäs erikoistuminen. Kristiina Heiniemi-Pulkkinen

Diaari Luokka AP RP 3 CB41 HealthAccess / Access to Distant Markets in Health and Wellness Nähtävänäolo Tallinn Science Park Tehnopol

BIOENV Laitoskokous Departmental Meeting

Computer based team play analysis in ice hockey coaching - an objective way to have feedback. Jouko Lukkarila

BDD (behavior-driven development) suunnittelumenetelmän käyttö open source projektissa, case: SpecFlow/.NET.

MUSEOT KULTTUURIPALVELUINA

Rakentamisen näkymät EU-alueella ja Suomessa

Network to Get Work. Tehtäviä opiskelijoille Assignments for students.

Huleveden pitoisuuksien ajallinen ja alueellinen vaihtelu Maija Taka University of Helsinki 1

Strategiset kyvykkyydet kilpailukyvyn mahdollistajana Autokaupassa Paula Kilpinen, KTT, Tutkija, Aalto Biz Head of Solutions and Impact, Aalto EE

ICES: 110 vuotta tiedettä ja merentutkimusta: Mitä ja miksi? Dr. Kai Myrberg ICES Delegaatti Helsinki

Opiskelijat valtaan! TOPIC MASTER menetelmä lukion englannin opetuksessa. Tuija Kae, englannin kielen lehtori Sotungin lukio ja etälukio

Windows Phone. Module Descriptions. Opiframe Oy puh Espoo

Helsinki Region Infoshare 2013

Helsinki Metropolitan Area Council

Reliable sensors for industrial internet

Computer based team play analysis in ice hockey coaching - an objective way to have feedback. Jouko Lukkarila

FinFamily PostgreSQL installation ( ) FinFamily PostgreSQL

7.4 Variability management

Export Demand for Technology Industry in Finland Will Grow by 2.0% in 2016 GDP growth 2016/2015, %

Poistuvat kurssit ja korvaavuudet (RRT ja YYT)

Skene. Games Refueled. Muokkaa perustyyl. for Health, Kuopio

Pricing policy: The Finnish experience

Kansainväliset verkostot ja säätiöt varainhankinnan kehittämisessä

Co-Design Yhteissuunnittelu

Table S2. S. thermophilus CRISPR spacer sequence analysis.

LYTH-CONS CONSISTENCY TRANSMITTER

Harjavallan sulaton raskasmetallipäästöt

Social and Regional Economic Impacts of Use of Bioenergy and Energy Wood Harvesting in Suomussalmi

momo Car-Sharing sharing smart solutions for urban transport

ATLAS-kartan esittely - Peli palveluiden yhteiskehittämisen menetelmistä Päivi Pöyry-Lassila, Aalto-yliopisto

JA CHALLENGE Anna-Mari Sopenlehto Central Administration The City Development Group Business Developement and Competence

Basic Flute Technique

ESITTELY. Valitse oppilas jonka haluaisit esitellä luokallesi ja täytä alla oleva kysely. Age Grade Getting to school. School day.

MALE ADULT FIBROBLAST LINE (82-6hTERT)

Hankkeiden vaikuttavuus: Työkaluja hankesuunnittelun tueksi

SFS/SR315 Tekoäly Tekoälyn standardisointi

Kansainvälisiä tutkimus- ja kehitysprojekteja ekotehokkaan rakennetun ympäristön tuottamiseen, käyttöön ja ylläpitoon

SUOJAVYÖHYKEILMANVAIHTO ESTÄMÄÄN EPÄPUHTAUKSIEN LEVIÄMISTÄ SISÄTILOISSA

Constructive Alignment in Specialisation Studies in Industrial Pharmacy in Finland

Miehittämätön meriliikenne

Transport and Infrastructure what about the future? Professor Jorma Mäntynen Tampere University of Technology

ISEB/ISTQB FOUNDATION CERTIFICATE IN SOFTWARE TESTING III

Use of spatial data in the new production environment and in a data warehouse

VUOSI 2015 / YEAR 2015

16. Allocation Models

Informaatioteknologia vaikuttaa ihmisten käyttäytymiseen ja asenteisiin

Julkaisun laji Opinnäytetyö. Sivumäärä 43

Collaborative & Co-Creative Design in the Semogen -projects

VALTION MAATALOUSKONEIDEN TUTKIMUSLAITOS. Test report

National Building Code of Finland, Part D1, Building Water Supply and Sewerage Systems, Regulations and guidelines 2007

LANSEERAUS LÄHESTYY AIKATAULU OMINAISUUDET. Sähköinen jäsenkortti. Yksinkertainen tapa lähettää viestejä jäsenille

The role of 3dr sector in rural -community based- tourism - potentials, challenges


Transkriptio:

Efficient regeneration system and Agrobacteriummediated transformation of Vetiver PT www.acolor.net 1

Outline: Part I: Why (Background) Part II: Some concrete work we have done Part III: Prospects to further this research PT www.acolor.net 2

Part I Research Background PT www.acolor.net 3

PT www.acolor.net 4

PT www.acolor.net 5

Water and soil erosion The quantity of soil and water erosion in china is above 8 billion tons annually. (Peng Keshan,2004) PT www.acolor.net 6

Desertification Water contamination Deforestation PT www.acolor.net 7

PT www.acolor.net 8

Magical Plant -- Vetiver PT www.acolor.net 9

Slope protection and stabilization PT www.acolor.net 10

Pollution rehabilitation PT www.acolor.net 11

Poor tolerance to low temperature PT www.acolor.net 12

Application distributing map of vetiver in China Beijing PT www.acolor.net 13

Research objective To enhance cold tolerance, a coldresistant gene is introduced into vetiver cells using molecular technology of gene transformation, and as a result, make this excellent grass play a more positive role in environment restoration in North China and other parts of the world. PT www.acolor.net 14

Establishment of regeneration system Establishment of transformation system Construction of plant expression vector Agrobacterium-mediated transformation Molecular analysis cold stress tolerance assays PT www.acolor.net 15

Trehalose-6-phosphate synthase gene otsa gene PT www.acolor.net 16

lamb Outer membrane 2x glucose TreA trehalose EIICB Glc EIICB Tre Inner membrane EIIA Glc EIIA Glc OtsA OtsB Glucose-6-phosphate Trehalose-6-phosphate trehalose + UDP-glucose Ots A TreC Glucose + glucose-6-phosphate Glk glucose-6-phosphate glycolysis Metabolic Pathway of trehalose in E.Coli (Crowe et al., 1990; Strom et al., 1993) PT www.acolor.net 17

Trehalose Protectant of protein and membrane Osmoprotectant ---Crowe et al., 1990; Strom et al., 1993. PT www.acolor.net 18

otsa gene Tobacco Potato ---Goddijn et al., 1997; Yeo et al., 2000; Wang et al., 2003 Sugarcane PT www.acolor.net 19

1 2 3 1500bp A PCR amplification and restriction analysis of otsa gene 100 bp ladder: 5,000, 3,000, 2,000, 1,500, 1,000, 900, 800, 700, 600, 500, 400, 300, 200, 100 PT www.acolor.net 20

Part II What concrete work have we done? 2.1 Establishment of an efficient regeneration system of vetiver PT www.acolor.net 21

B PT www.acolor.net 22

Induction medium: MS + 2.0 mg /L 2,4-D + 0.5 mg /L KT Differentiation medium : MS + 1.0 mg/ L 6BA Rooting medium: ½ MS + 0.1mg/L IBA + 0.1 mg/ L PP333 PT www.acolor.net 23

Development process of a somatic embryo of Vetiver PT www.acolor.net 24

2.2 Establishment of genetic transformation system for vetiver grass PT www.acolor.net 25

Con. of Agr.tumefaciens 0.4-0.5 OD Con. of acetosyringone (AS) 200 µm Co-cultivation temperature 22-25 Duration of co-cultivation 3-4 d PT www.acolor.net 26

2.3 Construction of plant expression vector p1301un-otsa PT www.acolor.net 27

ots A Ap pwy 4200bp Sal 1 otsa PT www.acolor.net 28

ots A PT www.acolor.net 29

Construction of plant expression vector p1301un-otsa otsa pwy1 -otsa 4200bp SmaI/SacI Sac I PT www.acolor.net 30

PCR amplification Restriction digestion Ligation Transformation PT www.acolor.net 31

1 2 3 4 5 6 1 2 3 4 5 15,517 bp a b c 1500 bp a b c (a) PCR amplification and restriction analysis of otsa gene (b) Restriction analysis of plasmid p1301un (c) Restriction analysis of recombinant plasmid p1301un-otsa PT www.acolor.net 32

UBI tttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgtta cttctgcaggtcgactctagaggatccccgggccggtaccatgaggatcagccgctaaaaaaggtgaaa aaaggtaacattacgtgggcctcttttaacctcagcgaacaggaccttgacgaatactacaaccaattctc caatgccgttctctggcccgcttttcattatcggctcgatctggtgcaatttcagcgtcctgcctgggacggct atctacgcgtaaatgcgttgctggcagataaattactgccgctgttgcaagacgatgacattatctggatcc acgattatcacctgtt(c)gccatttgcgcatgaattacgcaaacggggagtgaataatcgcattggtttctt tctgcatattcctttcccgacaccggaaatcttcaacgcgctgccgacatatgacaccttgcttgaacagctt tgtgattatgatttgctgggtttccagacagaaaacgatcgtctggcgttcctggattgtctttctaacctgac ccgcgtcacgacacgtagcgcaaaaagccatacagcctggggcaaagcatttcgaacagaagtctaccc gatcggcattgaaccgaaagaaatagccaaacaggctgccgggccactgccgccaaaactggcgcaac ttaaagcggaactgaaaaacgtacaaaatatcttttctgtcgaacggctggattattccaaaggtttgcca gagcgttttctcgcctatgaagcgttgctggaaaaatatccgcagcatcatggtaaaattcgttatacccag attgcaccaacgtcgcgtggtgatgtgcaagcctatcaggatattcgtcatcagctcgaaaatgaagctgg acgaattaatggtaaatacgggcaattaggctggacgccgctttattatttgaatcagcattttgaccgtaa attactgatgaaaatattccgctactctgacgtgggcttagtgacgccactgcgtgacgggatgaacctgg tagcaaaagagtatgttgctgctcaggacccagccaatccgggcgttcttgttctttcgcaatttgcgggag cggcaaacgagttaacgtcggcgttaattgttaacccctacgatcgtgacgaagttgcagctgcgctggat cgtgcattgactatgtcgctggcggaacgtatttcccgtcatgcagaaatgctggacgttatcgtgaaaaa cgatattaaccactggcaggagtgcttcattagcgacctaaagcagatagttccgcgaagcgcggaaag ccagcagcgcgataaagttgctacctttccaaagcttgcgtaggagctcgaatttccccgatcgttcaaac atttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaat tacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcc cgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgc ggtgtcatctatgttactagatcgggaattc OTSA NOS DNA sequence analysis of p1301un-otsa (Ubi-otsA-Nos) PT www.acolor.net 33

Plant expression vector p1301un-otsa PT www.acolor.net 34

2.4 Genetic transformation mediated by EHA105/p1301UN-otsA PT www.acolor.net 35

Co-cultivation Resistance selection Molecular analysis Cold stress tolerance assays PT www.acolor.net 36

GUS assay Calli co-cultivation after 3 days A PT www.acolor.net 37

hyg B resistant calli B Calli selection after 4 weeks PT www.acolor.net 38

PT www.acolor.net 39

Hyg B resistant buds A: Resistant buds cultivation after 4 weeks B: Control PT www.acolor.net 40

Hyg B resistant plantlets Resistant plantlets after 2 months PT www.acolor.net 41

Part III Further research plan Southern analysis of the putative transformants Cold tolerance analysis of transgenic plants PT www.acolor.net 42

Research goal To screen a new cultivar of vetiver with cold tolerance or other resistance ability by gene engineering, and make this excellent grass playing more effective role in environment restoration and protection in the world. PT www.acolor.net 43

My dream PT www.acolor.net 44

A new beginning PT www.acolor.net 45

Acknowledgments This research was supported by the Natural Science Foundation of China and the Wallace Genetic Foundation through the Vetiver Network. This paper was conferred the Innovation Prize by the Vetiver Network, so we wish to thank the Vetiver Network for encouragement to us. Mr. Frank Mason from Australia provided me with parts of expenses for attending the conference, thereby I would like to express my heartfelt thanks for his generosity and kindness. PT www.acolor.net 46

PT www.acolor.net 48