Biomedicum Helsinki 10 vuotta: tutkimusohjelmat, palkittuja tutkijoita, Suomen Akatemian huippuyksiköissä olevat tutkijat, akatemiaprofessorit

Koko: px
Aloita esitys sivulta:

Download "Biomedicum Helsinki 10 vuotta: tutkimusohjelmat, palkittuja tutkijoita, Suomen Akatemian huippuyksiköissä olevat tutkijat, akatemiaprofessorit"


1 Biomedicum Helsinki 10 vuotta: tutkimusohjelmat, palkittuja tutkijoita, Suomen Akatemian huippuyksiköissä olevat tutkijat, akatemiaprofessorit Genomibiologian tutkimusohjelma Ohjelma pyrkii selvittämään signaalinvälitysverkostojen kokonaisvaltaista analysointia ja vaikutusta useisiin tärkeisiin solun sisäisiin prosesseihin kuten solusykliin löytämään syövälle altistavien ja syövän kehittymistä edesauttavia geenejä käyttämällä laskennallisia malleja ja suurikapasiteettimittauksia muuntamaan genominlaajuiset tutkimustulokset diagnostisiksi testeiksi ja terapeuttisiksi kohteiksi tavoitteisiin hyödyntämällä useita suurikapasiteettimittausteknologioita genomiikan, DNA:n kopioinnin säätelyn ja solutason funktionaalisen seulonnan aloilta. Tutkimustulokset yhdistetään käyttämällä uusia laskennallisia menetelmiä, jotka mahdollistavat havaintojen luotettavan tulkinnan. Akatemiaprofessori Lauri Aaltonen, johtaja - ryhmä selvittää periytyvän kasvainalttiuden molekyylitaustaa kliinisistä piirteistä toiminnallisiin solupohjaisiin tutkimuksiin. Akatemiatutkija Päivi Ojala, varajohtaja - ryhmä tutkii virusten aiheuttamaa syöpää käyttäen mallina Kaposin sarkooma herpesvirusta. Dosentti Sampsa Hautaniemi - ryhmä tutkii ja soveltaa laskennallisia menetelmiä syövän kehittymisen kannalta tärkeiden molekulaaristen mekanismien ymmärtämiseksi Professori Heikki Järvinen - ryhmä on ollut keskeisessä asemassa perinnöllisten syöpien aineistojen keräämisessä ja hyödyntämisessä. Erityisen kiinnostuksen kohteena on HNPCC-paksusuolisyöpä sekä mahasuolikanavan polyyppeja aiheuttava Peutz-Jeghers oireyhtymä Professori Olli Kallioniemi ja dosentti Outi Monni - ryhmät selvittävät syövässä esiintyviä geenivirheitä genominlaajuisesti. Syövän kehittymiseen johtavia muutoksia kartoitetaan sirupohjaisilla työkaluilla ja tietoa hyödynnetään lääkkeiden ja diagnostiikan kehittämisessä. Dosentti Juha Klefström - ryhmä selvittää, kuinka solut puolustautuvat ohjelmoidun solukuoleman eli apoptoosin avulla syöpägeenien toimintaa vastaan. Tutkija Kaisa Lehti - ryhmä keskittyy syövissä tapahtuvan solujen liikkeen ja kudosten muokkauksen mekanismien selvittämiseen. Tavoitteena on kolmiulotteisia solujen kasvu- ja invaasiomalleja hyväksi käyttäen oppia ymmärtämään, kuinka solukalvoproteaasien välittämä solun pinnan proteiinien pilkkominen osallistuu solun signaloinnin, adheesion ja solun tukirangan dynamiikan koordinointiin kasvainten leviämisessä. Tutkija Sirpa Leppä - tavoitteena on karakterisoida imukudossyöpien eli lymfoomien biologisia ennustetekijöitä ja soveltaa tietoa lymfoomapotilaiden hoidonsuunnittelussa ja kehitystyössä kohti tehokkaampia ja yksilöllisempiä hoitovaihtoehtoja. Professori Tomi Mäkelä - ryhmä selvittää molekyylilääketieteen keinoin solujakautumista sääteleviä signalointireittejä ja niiden häiriöitä syövissä. Tutkija Ari Ristimäki - ryhmä tutkii tulehdukseen liittyvien geenituotteiden vaikutusta syövän leviämiseen ja syöpäpotilaiden ennusteeseen. Professori Jussi Taipale - ryhmä kehittää ja köyttää geniminlaajuisia solupohjaisia seulontateknologioita biolääketieteen isojen avointen kysymysten selvittämiseksi

2 Molekyylilääketieteen tutkimusohjelma Molekyylilääketieteen tutkimusohjelman tavoite on hyödyntää genomiprojektien ja genominlaajuisten analyysimenetelmien antamia mahdollisuuksia tutkia ainutlaatuisia suomalaisia perhe-ja väestönäytteitä. Ohjelman tutkijat yhdistävät korkeatasoisen geneettisen, epidemiologisen ja kliinisen osaamisen ja hyödyntävät uusimpia genominlaajuisia analyysimenetelmiä sekä relevantteja tautien eläinmalleja. Ryhmät myös kehittävät uusia biolaskennan ja bioinformatiikan menetelmiä genomin laajuisen tiedon tulkitsemisessa selvittääkseen sairauksien syntyä ja etenemistä. Ohjelma yhdistää kliiniset, epidemiologiset ja perustutkimuksen tutkijaryhmät. Näin syntyy paitsi kansainvälisesti kilpailukykyinen molekyylilääketieteen tutkimusyksikkö, myös vahva koulutusyksikkö, jossa tulevisuuden tutkijat saavat monipuolisen tutkijakoulutuksen molekyylilääketieteen, genetiikan, epidemiologian ja biolaskennan alalla. Ohjelma linkkautuu vahvasti Suomen Akatemian kansantautien tutkimuksen huippuyksikköön sekä Pohjoismaiseen tautigeenien tutkimuksen huippuyksikköön. Akatemiatutkija Hannes Lohi, johtaja - ryhmä tutkii koirien monitekijäisten tautien geeniprofiileja. Professori Leif Groop - ryhmä tutkii aikuisiän diabeteksen geeniprofiileja. Professori Juha Kere - ryhmä tutkii astman, sidekudossairaus SLE:n ja kielen kehityksen häiriön dysleksian geeniprofiileja. Professori Kimmo Kontula, johtaja - ryhmä tutkii rytmihäiriöiden ja lihavuuden geenitaustaa ja rytmihäiriölääkkeiden farmakogenetiikkaa Professori Anna-Elina Lehesjoki - ryhmä tutkii epilepsiamuotojen geeniprofiileja. Professori Aarno Palotie - ryhmä tutkii migreenin geeniprofiileja. Professori Leena Peltonen-Palotie (ryhmä) - ryhmä tutkii sydän- ja veri Ryhmäjohtaja Päivi Saavalainen - ryhmä tutkii autoimmuunitautien, erityisesti keliakian geeniprofiileja. Dosentti Tiinamaija Tuomi - ryhmä aikuisiässä todettavien diabetesmuotojen syitä Professori(emerita) Marja-Riitta Taskinen - ryhmä tutkii rasva-aineenvaihdunnan häiriöiden ja valtimokovettumataudin genetiikkaa ja molekyylibiologiaa

3 Molekyyli- ja syöpäbiologian tutkimusohjelma Molekyyli- ja syöpäbiologian tutkimusohjelman tavoitteena on tuottaa uutta tietoa syövän syntymekanismeista ja tunnistaa uusia syövässä muuntuneita kohdegeenejä. Tutkimuksen kohteena ovat erityisesti perimän vauriovasteeseen, syövän kantasolujen kasvuun ja erilaistumiseen, veri- ja lymfasuonten uudismuodostukseen, invaasioon ja metastaasiin liittyvät tapahtumat. Ohjelmassa toimivissa 10 tutkijan ryhmissä yhdistyy toisiaan tukeva monipuolinen osaaminen ja tieto-taito. Tutkimusohjelma hyödyntää työssään tehoseulontaa käyttäen genomin kattavia geenikirjastoja ja lääkeaihiokirjastoja, huipputeknologiaa edellyttävää kuvantamisanalytiikkaa, ja kehittää uusia viruspohjaisia geenisiirtovektoreita ja vaativia siirtogeenisiä koe-eläinmalleja. Ohjelman vahvuuksia ovat sen monipuoliset edellytykset löydösten kriittiseen tarkasteluun solu- ja molekyylibiologisin tekniikoin yhdistyneenä vankkaan syöpätautien kliiniseen osaamiseen. Keskeisenä tavoitteena on löydösten nopea siirto translationaalisen tutkimuksen kautta syövän hoitoon. Professori Jorma Keski-Oja, johtaja - ryhmä tutkii kasvutekijöiden vaikutuksia syöpäkasvuun Akatemiaprofessori Kari Alitalo - ryhmä tutkii veri- ja imusuonten kehittymistä ja mahdollisuuksia käyttää niiden säätelymolekyylejä syövän sekä sydän- ja verisuonitautien hoidossa. Dosentti Akseli Hemminki - ryhmä selvittää, miten geeniterapiaa ja syöpäsoluja tappavia viruksia voi käyttää syövän hoidossa. Dosentti Carina Holmberg-Still - ryhmä tutkii proteiinien pilkkoutumista säätelevää ubikitiini-proteasomijärjestelmää C. elegans sukkulamatomallin avulla. Professori Heikki Joensuu - ryhmä tutkii syöpätautien molekyylimekanismeja ja täsmähoitoja. Dosentti Katri Koli - tutkimusryhmän keskeinen tutkimusalue on TGF-beta/BMP-geeniperheen kasvutekijöiden toimintamekanismit erityisesti keuhkofibroosin ja syöpäsairauksien patogeneesissä. Dosentti Pirjo Laakkonen - ryhmä etsii syöpäkasvaimen etäpesäkkeiden muodostumisessa keskeisiä merkkimolekyylejä ja sellaisia peptidejä, jotka verenkiertoon ruiskutettuna toimisivat lääkettä tai merkkiainetta kuljettavina lähetteinä syöpäkasvaimeen. Professori Marikki Laiho - ryhmä tutkii syöpäsoluissa tapahtuneita geenivirheitä. Akatemiatutkija Pipsa Saharinen - tutkimusryhmän tavoitteena on ymmärtää molekyylitasolla Angiopoietiini-kasvutekijöiden ja Tie-reseptorityrosiinikinaasien muodostaman signaalinsiirtoketjun toimintaa stabiileissa ja syöpäkasvaimen verisuonten aktivoituneissa endoteelisoluissa. Angiopoietiini-Tie signaalinsiirtoreitti on välttämätön veri- ja imusuonten muodostumiselle yksilönkehityksen aikana. Dosentti Petri Salvén - ryhmä tutkii kantasolujen roolia syövän kasvussa.

4 Molekyylineurologian tutkimusohjelma Tutkimusohjelma keskittyy neurologisten ja neuropsykiatristen sairauksien molekyylitason tapahtumien selvittämiseen. Vahvan perustutkimuksellisen asiantuntemuksen keinoin ohjelman seitsemän tutkijaa ryhmineen etsii tauteja aiheuttavia ja niille altistavia geenejä ja tutkii tautien mekanismeja solutasolla, erilaisissa tautimalleissa, potilaiden kudosmateriaaleissa ja potilasaineistoissa. Tautimekanismien tuntemuksen avulla etsitään ja tutkitaan sellaisia lääkeaineita ja kemiallisia yhdisteitä, joilla taudin etenemiseen voidaan vaikuttaa. Tautimekanismien ja riskitekijöiden tuntemuksen perusteella potilaille voidaan myös antaa elämäntapaneuvontaa. Ohjelman suora yhteys lasten ja aikuisten neurologian klinikkoihin mahdollistaa tutkimustiedon tehokkaan hyödyntämisen potilaiden diagnostiikassa ja hoidossa. Professori Anu Wartiovaara, johtaja - ryhmä tutkii hermoston ja lihasten rappeumatautien mitokondriotaustoja ja hoitoa; erityisfokus Parkinsonin tauti, periytyvät ataksiataudit, ja lasten mitokondriotaudit Dosentti Pentti Tienari, varajohtaja - ryhmä tutkii hermoston rappeutumatautien, erityisesti MS-taudin, tautimekanismia ja hoitoa. Tutkija Brendan Battersby - ryhmä tutkii mitokondrioiden, perimän säätelyä ja sen roolia hermoston rappeumasairauksissa. Yliopistonlehtori Ove Eriksson - ryhmä tutkii mitokondrioiden osuutta solukuolemassa na jäiden mekanismien osuutta hermoston sairauksissa. Dosentti Iiris Hovatta - ryhmä tutkii neuropsykiatristen sairauksien molekyylimekanismeja ja hoitoa. Dosentti Perttu Lindsberg - ryhmä tutkii aivoinfarktin altistavia tekijöitä ja molekyylitason tautimekanismia sekä hoitoa. Professori Timo Otonkoski - ryhmän tutkimuskohteena on lääketieteellinen kantasolututkimus Tutkija Tiina Tyni - ryhmä tutkii lasten rasvahappoaineenvaihdunnan tautien mekanismeja

5 Yhteistyössä olevat tutkimusohjelmat Infektiobiologian tutkimusohjelma (Haartman-insituutti) Infektiobiologian tutkimusohjelma kattaa mikrobissa ja isännässä tapahtuvat molekyyli- ja solutason prosessit mikrobin kolonisaation, invaasion ja infektion aikana. Infektiobiologian tutkimus on nykyisin erittäin tärkeää, koska pandemioiden uhka on lisääntynyt globalisaation ja uusien infektioiden myötä mikrobien antibioottiresistenssi ja sairaalainfektiot ovat lisääntyneet monet infektiot ovat edelleen valtava ongelma kehitysmaissa (esim. keuhkokuume, ripulitaudit, tuberkuloosi, malaria ja HIV/AIDS) Toisaalta genomien selvitys on avannut uusia tutkimusmahdollisuuksia. Ohjelman tarkoitus on yhdistää ja hyödyntää nopeasti lisääntyvää tietoa mikrobeista, isännän vasteista ja tekniikoista. Professori Seppo Meri, johtaja - ryhmä tutkii, miten taudinaiheuttajat pystyvät väistämään elimistön tärkeän puolustusjärjestelmän - komplementtijärjestelmän - ja mitkä yksilölliset ominaisuudet altistavat ihmisen infektioille.. Professori Klaus Hedman - ryhmä selvittää ihmisen ssdna-virusten esiintyvyyttä ja tarttumisteitä, solu- ja molekyylibiologisia mekanismeja, isäntäsoluja, kasvuominaisuuksia ja tautiyhteyksiä. Dosentti Alexander Plyusnin - ryhmä tutkii jyrsijöiden ja eräiden muiden eläinten levittämiä zoonoosi-viruksia, kuten hanta-viruksia, joihin kuuluu muun muassa Puumala-virus. Professori Risto Renkonen - tutkimusryhmä on kiinnostunut tulehdustautien systeemibiologiasta. He soveltavat laaja-alaisia tutkimusmenetelmiä ja pyrkivät ymmärtämään, mitä allergisen reaktion alussa tapahtuu, kun elimistön pintasolukko, eli epiteeli kohtaa siitepölyn allergeeneja. Professori Kalle Saksela - ryhmä tutkii virusten ja isäntäsolun vuorovaikutusta molekyylibiologian keinoin. Vuorovaikutuksen ymmärtäminen auttaa muun muassa syöpäsairauksien tutkimisessa. Professori Mikael Skurnik - ryhmä tutkii Yersinia-suvun bakteerien virulenssitekijöitä, taudinaiheuttamiskyvylle tarpeellisia rakenteita ja ominaisuuksia. Nainen ja terveys (Biomedicum Helsinki, Naistensairaala, Lasten ja nuorten sairaala) Tutkimusten kohteena on muun muassa ennaltaehkäisevä papilloomavirusrokote papilloomavirusrokotteen ja kohdunkaulansyövän seulonnan synergia klamydia ja lisääntymisterveys yhden alkion siirto ja in vitro fertilisaatio hormonikierukan terveyshyödyt raskaus ikkunana naisen myöhempään terveyteen naisten yleisimpien syöpien biopankkiaineistojen hyödyntäminen munasarjan kehitysbiologia

6 Gynekologiset infektiot Professori Jorma Paavonen, johtaja- - ryhmä tutkii gynekologisia tulehdussairauksia, erityisesti papilloomaviruksen aiheuttamaa HPV-infektioita sekä klamydiaa. Primaaripreventio HPV-rokotteella vaatii isoja tehotutkimuksia. Toinen tutkimusaihe on selvittää tulehduksen osuutta keskossynnytyksissä. Dosentti Pekka Nieminen - ryhmä kehittää kohdunkaulan syövän seulontaa ja tutkii trendejä tämän syövän ilmaantumisessa. Tärkeä kysymys on HPV-rokotusohjelman vaikutus seulontoihin. Lisääntymisterveys Dosentti Oskari Heikinheimo - ryhmä tutkii steroidihormonien käyttöä raskauden ehkäisyssä ja raskauden keskeytyksessä. Dosentti Risto Kaaja - ryhmän tutkimusaiheena on raskaus ikkunana naisen terveyteen. Dosentti Tomi Mikkola - ryhmä tutkii vaihdevuosien fysiologiaa. Professori Aila Tiitinen - ryhmä tutkii lapsettomuushoitojen optimointia ja hedelmöityshoitojen turvallisuutta. Munasarja- ja rintasyöpä Osastonylilääkäri Ralf Bützow - ryhmä tutkii munasarjasyövän molekulaarista patologiaa ja etsii uusia mahdollisia täsmähoidon kohdemolekyylejä Dosentti Heli Nevanlinna - ryhmä selvittää geneettisten tekijöiden liittymistä rintasyövän sairastumisvaaraan, syövän ilmiasuun tai etenemiseen ja eloonjäämisennusteeseen. Kehitysbiologia Professori Markku Heikinheimo ja dosentti Tiina Laine - ryhmät tutkivat geenisäätelyä, kehitystä ja kasvaimia useissa elimissä ja sukurauhasissa. Munasarjoja koskevissa töissä tutkijat selvittävät muun muassa munarakkuloiden kehittymisen säätelyn ja toiminnan mekanismeja, ympäristömyrkkyjen vaikutuksia munarakkuloiden soluihin sekä eri tyyppisiä munasarjan kasvaimia. Kansalliset ja kansainväliset palkinnot ja suurapurahat Kymmenvuotisen toiminnan aikana Biomedicum Helsingissä työskenteleville tutkijoille on myönnetty yli 50 sekä kansallista että kansainvälistä lääketieteen alan palkintoa ja suurapurahaa. Esimerkkejä palkinnoista: Professori Lauri Aaltonen, Genomibiologia tutkimusohjelma: Matti Äyräpää palkinto, 2005 Syöpäsäätiön suurapuraha, 2010 Euroopan tutkimusneuvoston ERC Advanced Grant rahoitus, 2011 Akatemiaprofessori Kari Alitalo, Molekyyli- ja syöpäbiologia -tutkimusohjelma: Fernström säätiön suuri pohjoismainen tiedepalkinto (Stora Fernströmpriset), 2005 The Louis-jeantet Prize for Medicine, 2006 InBev-Baillet Latour International Health Prize tiedepalkinto, 2009 Anders Jahre tiedepalkinto, 2010 Euroopan tutkimusneuvoston ERC Advanced Grant rahoitus, 2011 Professori Hannes Lohi, HY Lääketieteellinen genetiikka: Akatemiapalkinto, 2007 Suomen Nuorkauppakamari ry, vuoden nuori menestyjä, 2009 Euroopan tutkimusneuvoston tutkimusapuraha, 2010 Professori Jussi Taipale, Genomibiologia tutkimusohjelma: Sigrid Juselius säätiön juhlapalkinto 2005 EMBO:n nuoren tutkijan palkinto, 2006 Medix-palkinto, 2007 Anders Jahre palkinto, 2008 Professori Anu Wartiovaara, Molekyylineurologia tutkimusohjelma: Anders Jahre palkinto, 2003

7 Nuoremman tutkijan Europe & Medécine palkinto, 2004 Euroopan tutkimusneuvoston ERC Advanced Grant rahoitus, 2011 Muita lukuisia palkintoja saaneita tutkijoita ovat mm. professori Akseli Hemminki, professori Juha Kere, professori Mikael Knip, professori Mikko Niemi ja professori Ulf-Håkan Stenman. Biomedicum Helsingin tutkijat Suomen Akatemian huippuyksiköissä Akatemiaprofessori Kari Alitalo (koordinaattori): Syövän biologian huippuyksikkö - mukana huippuyksikössä myös professori Jorma Keski-Oja, professori Marikki Laiho ja dosentti Petri Salvén Yliopistonlehtori Synnöve Carlson (osa huippuyksikköä): Systeemisen neurotieteen ja aivokuvantamisen huippuyksikkö Akatemiaprofessori Heikki Joensuu (osa huippuyksikköä): Ihmisen puolustsusmekanismit huippuyksikkö Professori Olli Kallioniemi (koordinaattori): Genomitiedon hyödyntämisen huippuyksikkö - mukana huippuyksikössä myös akatemiaprofessori Lauri Aaltonen ja professori Tomi Mäkelä Professori Kimmo Kontula (osa huippuyksikköä): Kansantautien genetiikan tutkimuksen huippuyksikkö - mukana huippuyksikössä myös professori Juha Kere ja professori Aarno Palotie Professori Anu Wartiovaara (osa huippuyksikköä): Suomalainen mitokondriotautien ja ikääntymisen huippuyksikkö (FinMIT) Biomedicum Helsingin akatemiaprofessorit Akatemiaprofessori Lauri Aaltonen Akatemiaprofessori Kari Alitalo Akatemiaprofessori Elina Ikonen Akatemiaprofessori Heikki Joensuu Akatemiaprofessori Jussi Taipale Lisätiedot: Johtaja, professori Olli A. Jänne Viestintäkoordinaattori Kirsi Varmo

Maud Kuistilan palkinto Professori Tero Kivelälle

Maud Kuistilan palkinto Professori Tero Kivelälle Maud Kuistilan palkinto Professori Tero Kivelälle Maud Kuistilan palkinto myönnetään vuosittain ansioituneelle tutkijoiden kouluttajalle. Dosentti Tom Pettersson Medcare-säätiön tunnustuspalkinto reumasairauksien


Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä

Huippuyksikköseminaari 12.11.2013. Leena Vähäkylä Huippuyksikköseminaari 12.11.2013 Leena Vähäkylä Menestystarinat Akatemian viestinnässä Akatemian pitkäjänteinen rahoitus laadukkaaseen tutkimukseen näkyy rahoitettujen ja menestyneiden tutkijoiden tutkijanurasta


Vuoden 2004 apurahat. Maud Kuistilan muistosäätiön apurahojen saajat vuonna 2004. Nimi Jaettu summa ( ) Tutkimusaihe Paikkakunta

Vuoden 2004 apurahat. Maud Kuistilan muistosäätiön apurahojen saajat vuonna 2004. Nimi Jaettu summa ( ) Tutkimusaihe Paikkakunta Vuoden 2004 apurahat Maud Kuistilan muistosäätiö on jakanut vuoden 2004 apurahat lääketieteelliseen tutkimukseen 55 tutkijalle. Apurahojen yhteissumma on 284 200 euroa. Suurimman apurahan 9000 euroa sai


Matti Äyräpään palkinto 2014 Professori Leif Groop. FiDiPro-professori, Helsingin yliopisto Diabetestutkimuskeskuksen johtaja, Lundin yliopisto

Matti Äyräpään palkinto 2014 Professori Leif Groop. FiDiPro-professori, Helsingin yliopisto Diabetestutkimuskeskuksen johtaja, Lundin yliopisto Matti Äyräpään palkinto 2014 Professori Leif Groop FiDiPro-professori, Helsingin yliopisto Diabetestutkimuskeskuksen johtaja, Lundin yliopisto Pohjolan ja Suomi-yhtiön lääketieteen palkinto 2014 Professori


Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja


Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla


HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku

HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku HPV-infektion ja kohdunkaulan syövän esiasteiden luonnollinen kulku Olli Carpén VARSINAIS-SUOMEN SAIRAANHOITOPIIRI HOSPITAL DISTRICT OF VARSINAIS-SUOMI Kohdunkaulan syöpä ja esiasteet HPV ja kohdunkaulan


Nimi / (UM = apuraha ulkomailla työskentelyä varten) Summa ( ) Tutkimusaihe Asuinkunta tai työskentelykunta

Nimi / (UM = apuraha ulkomailla työskentelyä varten) Summa ( ) Tutkimusaihe Asuinkunta tai työskentelykunta Vuoden 2011 apurahat Maud Kuistilan Muistosäätiö on jakanut vuoden 2011 apurahat lääketieteelliseen tutkimukseen 42 tutkijalle. Apurahojen yhteissumma on 216 000 euroa ja ne on tarkoitettu 137 tutkijakuukauden


HELSINGIN YLIOPISTO. HISTORIAA 1640 Kuninkaallinen Turun Akatemia 250 opiskelijaa, 11 professuuria

HELSINGIN YLIOPISTO. HISTORIAA 1640 Kuninkaallinen Turun Akatemia 250 opiskelijaa, 11 professuuria HISTORIAA 1640 Kuninkaallinen Turun Akatemia 250 opiskelijaa, 11 professuuria 1809 Suomi Venäjän autonomiseksi suuriruhtinaskunnaksi 1812 Helsingistä Suomen pääkaupunki 1827 Turun palo; Akatemia Helsinkiin


Laboratorion merkitys infektioiden diagnostiikassa. Risto Vuento Laboratoriokeskus PSHP

Laboratorion merkitys infektioiden diagnostiikassa. Risto Vuento Laboratoriokeskus PSHP Laboratorion merkitys infektioiden diagnostiikassa Risto Vuento Laboratoriokeskus PSHP Mikrobin ja ihmisen suhde Hyödylliset mikrobit, henkilön oma mikrobisto (ns. normaalifloora) Käsitteellä infektiotauti


Alanne Mervi 9000 Sydän- ja verisuonitauteihin liittyvän tulehdusreaktion genetiikka Helsinki

Alanne Mervi 9000 Sydän- ja verisuonitauteihin liittyvän tulehdusreaktion genetiikka Helsinki Vuoden 2007 apurahat Maud Kuistilan Muistosäätiö on jakanut vuoden 2007 apurahat lääketieteelliseen tutkimukseen 44 tutkijalle. Apurahojen yhteissumma on 317 500 euroa. Maud Kuistilan Muistosäätiö jakaa


Miten geenitestin tulos muuttaa syövän hoitoa?

Miten geenitestin tulos muuttaa syövän hoitoa? ChemBio Helsingin Messukeskus 27.-29.05.2009 Miten geenitestin tulos muuttaa syövän hoitoa? Kristiina Aittomäki, dos. ylilääkäri HYKS Perinnöllisyyslääketieteen yksikkö Genomin tutkiminen FISH Sekvensointi


Kutsu. Professoriluennot torstaina 4.12.2014 LÄÄKETIETEELLINEN TIEDEKUNTA

Kutsu. Professoriluennot torstaina 4.12.2014 LÄÄKETIETEELLINEN TIEDEKUNTA Kutsu Professoriluennot torstaina 4.12.2014 LÄÄKETIETEELLINEN TIEDEKUNTA Kutsu kuulemaan niitä julkisia esitelmiä, jotka Oulun yliopiston nimitetyt professorit pitävät lääketieteellisen tiedekunnan Leena


Päästä varpaisiin. Tehtävät. Ratkaisut. Päivitetty 8.4.2013 ISBN 978-951-37-6416-6, 978-951-37-6417-3, 978-951-6418-0. Sisällys (ratkaisut) Johdanto

Päästä varpaisiin. Tehtävät. Ratkaisut. Päivitetty 8.4.2013 ISBN 978-951-37-6416-6, 978-951-37-6417-3, 978-951-6418-0. Sisällys (ratkaisut) Johdanto OPETTAJAN AINEISTO Käyttöehdot Päästä varpaisiin Ihmisen anatomia ja fysiologia Eliisa Karhumäki Mari Kärkkäinen (os. Lehtonen) Päivitetty 8.4.2013 ISBN 978-951-37-6416-6, 978-951-37-6417-3, 978-951-6418-0


Pakolliset kurssit (OL PDDLOPD%,,

Pakolliset kurssit (OL PDDLOPD%,, Pakolliset kurssit (OL PDDLOPD%,, tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla tarkoittaa


Hoitotehoa ennustavat RAS-merkkiaineet Tärkeä apuväline kolorektaalisyövän lääkehoidon valinnassa Tämän esitteen tarkoitus Tämä esite auttaa ymmärtämään paremmin kolorektaalisyövän erilaisia lääkehoitovaihtoehtoja.


Tiesitkö tämän? Naisille. Miehille. Vanhemmille SIVU 2

Tiesitkö tämän? Naisille. Miehille. Vanhemmille SIVU 2 3 4 10 12 14 Tiesitkö tämän? Naisille Miehille Vanhemmille SIVU 2 4 Tiesitkö tämän? 5 Mikä on ihmisen papilloomavirus? Ihmisen papilloomavirus (HPV) on sukupuoliteitse leviävä virusinfektion aiheuttaja,


5.7. Biologia. Opetuksen tavoitteet

5.7. Biologia. Opetuksen tavoitteet 5.7. Biologia Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin


Tietoaineistot ja tutkimus. Kommenttipuheenvuoro: Arpo Aromaa

Tietoaineistot ja tutkimus. Kommenttipuheenvuoro: Arpo Aromaa Tietoaineistot ja tutkimus Kommenttipuheenvuoro: Arpo Aromaa Välittömiä kommentteja.. Arpo Aromaa Lääketieteellisen tutkimusetiikan seminaari 2 Tietojen keruu ja käyttö Kannattaako tietoja ihmisten terveydestä


Mitä julkisen terveydenhuollon pitäisi tarjota?

Mitä julkisen terveydenhuollon pitäisi tarjota? Mitä julkisen terveydenhuollon pitäisi tarjota? -tasa-arvo, priorisointi ja eettinen näkökulma. Helena Kääriäinen Tutkimusprofessori 17.10.2013 Esityksen nimi / Tekijä 1 Esimerkki genomiikan ulkopuolelta:


Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia


PROFESSORILUENTO. Professori Markus Juonala. Lääketieteellinen tiedekunta. Sisätautioppi

PROFESSORILUENTO. Professori Markus Juonala. Lääketieteellinen tiedekunta. Sisätautioppi PROFESSORILUENTO Professori Markus Juonala Sisätautioppi Lääketieteellinen tiedekunta 23.9.2015 Professori Markus Juonala pitää professoriluentonsa päärakennuksen Tauno Nurmela -salissa 23. syyskuuta 2015


TaLO-tapaukset Virusoppi. Vastuuhenkilöt: Tapaus 1: Matti Varis Tapaus 2: Veijo Hukkanen Tapaus 3: Sisko Tauriainen Tapaus 4: Ilkka Julkunen

TaLO-tapaukset Virusoppi. Vastuuhenkilöt: Tapaus 1: Matti Varis Tapaus 2: Veijo Hukkanen Tapaus 3: Sisko Tauriainen Tapaus 4: Ilkka Julkunen TaLO-tapaukset Virusoppi Vastuuhenkilöt: Tapaus 1: Matti Varis Tapaus 2: Veijo Hukkanen Tapaus 3: Sisko Tauriainen Tapaus 4: Ilkka Julkunen TaLO-tapaus 1 Uusi uhkaava respiratorinen virusinfektio Tapaus



KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN KANSAINVÄLINEN KATSAUS AJANKOHTAISEEN YMPÄRISTÖSAIRAUSTUTKIMUKSEEN Suomen Ympäristösairauskeskus perustettiin viime vuonna ajantasaisen ympäristösairaustiedon asiantuntijakeskukseksi. Tavoitteena on ajantasaisen,


Lakisääteisen eettisen toimikunnan tehtävät alueellinen yhteistyö

Lakisääteisen eettisen toimikunnan tehtävät alueellinen yhteistyö Lakisääteisen eettisen toimikunnan tehtävät alueellinen yhteistyö Tapani Keränen Itä-Suomen yliopisto; Pohjois-Savon sairaanhoitopiiri, tutkimusyksikkö ja eettinen toimikunta 21.3.2012 1 Alueelliset eettiset


HPV-rokote tulee rokotusohjelmaan mitä, kenelle, miksi?

HPV-rokote tulee rokotusohjelmaan mitä, kenelle, miksi? HPV-rokote tulee rokotusohjelmaan mitä, kenelle, miksi? Tuija Leino THL Kerron tässä alkavasta rokotusohjelmasta rokotteesta Miksi otettu ohjelmaan? Miltä taudilta suojaudutaan? Miksi otettu ohjelmaan


Maud Kuistilan Muistosäätiön apurahansaajat vuonna 2012

Maud Kuistilan Muistosäätiön apurahansaajat vuonna 2012 Vuoden 2012 apurahat Maud Kuistilan Muistosäätiö on jakanut vuoden 2012 apurahat lääketieteelliseen tutkimukseen 49 tutkijalle. Apurahojen yhteissumma on lähes 238 000 euroa ja ne on tarkoitettu 154 tutkijakuukauden


Geneettisen tutkimustiedon

Geneettisen tutkimustiedon Geneettisen tutkimustiedon omistaminen Tutkijan näkökulma Katriina Aalto-Setälä Professori, sisätautien ja kardiologian erikoislääkäri Tampereen Yliopisto ja TAYS Sydänsairaala Etiikan päivät 9.3.2016


3. 4.5.2011/18. Liite Virallisen lehden numeroon 55/13.5.2011. Toimittanut eduskuntatiedotus

3. 4.5.2011/18. Liite Virallisen lehden numeroon 55/13.5.2011. Toimittanut eduskuntatiedotus 3. 4.5.2011/18 Liite Virallisen lehden numeroon 55/13.5.2011 EDUSKUNNAN VIIKKO Toimittanut eduskuntatiedotus SISÄLLYSLUETTELO Muuta.................... 41 MUUTA Tiistai 3.5.2011 Valiokuntien vaaleissa


Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina

Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Synteettinen biologia Suomessa: Virukset synteettisen biologian työkaluina Minna Poranen Akatemiatutkija Helsingin yliopisto FinSynBio-ohjelma Suomen Akatemia Virukset synteettisen biologian työkaluina


3 Tieteellinen toiminta

3 Tieteellinen toiminta 3 Tieteellinen toiminta Kliinisen kardiologian tieteellinen tutkimustoiminta on huomattavasti lisääntynyt Suomessa kahden viimeisen vuosikymmenen aikana. Viime vuosikymmeninä on tehty myös ansiokasta kardiologian


Autoimmuunitaudit: osa 1

Autoimmuunitaudit: osa 1 Autoimmuunitaudit: osa 1 Autoimmuunitaute tunnetaan yli 80. Ne ovat kroonisia sairauksia, joiden syntymekanismia eli patogeneesiä ei useimmissa tapauksissa ymmärretä. Tautien esiintyvyys vaihtelee maanosien,


BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta

BIOLOGIA. Aihekokonaisuudet. Biologian opetuksessa huomioidaan erityisesti seuraavat aihekokonaisuudet: kestävä kehitys teknologia ja yhteiskunta BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja


PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea

PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea TIIA TALVITIE FM Tiedottaja, Fimea PÄIVI RUOKONIEMI LT, kliinisen farmakologian ja lääkehoidon erikoislääkäri Ylilääkäri, Fimea Syövän lääkehoitojen kehittäminen vaatii KOKO ALAN DIALOGIA Täsmälääkkeet


Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna

Syöpä. Ihmisen keho muodostuu miljardeista soluista. Vaikka. EGF-kasvutekijä. reseptori. tuma. dna Ihmisen keho muodostuu miljardeista soluista. Vaikka nämä solut ovat tietyssä mielessä meidän omiamme, ne polveutuvat itsenäisistä yksisoluisista elämänmuodoista, jotka ovat säilyttäneet monia itsenäisen


Biopankkilain valmistelun lyhyt historia

Biopankkilain valmistelun lyhyt historia Biopankkilain valmistelun lyhyt historia Puheenjohtaja Kimmo Pitkänen Biotekniikan neuvottelukunta Tutkijoiden ja kansanedustajien seura - TUTKAS Biotekniikan neuvottelukunta BIOPANKKIEN MERKITYS KANSALAISILLE


PROFESSORILUENTO. Professori Risto Kaaja. Lääketieteellinen tiedekunta. Sisätautioppi

PROFESSORILUENTO. Professori Risto Kaaja. Lääketieteellinen tiedekunta. Sisätautioppi PROFESSORILUENTO Professori Risto Kaaja Sisätautioppi Lääketieteellinen tiedekunta 18.11.2015 Professori Risto Kaaja pitää professoriluentonsa päärakennuksen Tauno Nurmela -salissa 18. marraskuuta 2015


5. Henkilökohtainen diagnostiikka ja hoito

5. Henkilökohtainen diagnostiikka ja hoito 5.2.2013 5. Henkilökohtainen diagnostiikka ja hoito Ohjelman tutkimusaiheet ovat infektiot ja tulehdussairaudet sekä syöpäsairaudet. Näiden tutkimusaiheiden osalta ohjelman tavoite on siirtää terveydenhuollon


Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä

Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Miten genomitieto on muuttanut ja tulee muuttamaan erikoissairaanhoidon käytäntöjä Genomitiedon vaikutus terveydenhuoltoon työpaja 7.11.2014 Sitra, Helsinki Jaakko Ignatius, TYKS Kliininen genetiikka Perimän


Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys.

Avainsanat: BI5 III Biotekniikan sovelluksia 9. Perimä ja terveys. Avainsanat: mutaatio Monitekijäinen sairaus Kromosomisairaus Sukupuu Suomalainen tautiperintö Geeniterapia Suora geeninsiirto Epäsuora geeninsiirto Kantasolut Totipotentti Pluripotentti Multipotentti Kudospankki


Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014

Kliiniset lääketutkimukset yliopistosairaalan näkökulma. Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Kliiniset lääketutkimukset yliopistosairaalan näkökulma Lasse Viinikka 18.3.2014 Etiikan päivä 2014 Tutkimustyön merkitys potilashoidon kannalta parantaa asiantuntijuutta korkeatasoinen tutkija on alansa


Tutkimusta lääkepolitiikan tueksi Kuopio 10.9.2015. Yhteiskunnallinen lääketutkimus Suomen Akatemian näkökulmasta. Heikki Ruskoaho hallituksen pj

Tutkimusta lääkepolitiikan tueksi Kuopio 10.9.2015. Yhteiskunnallinen lääketutkimus Suomen Akatemian näkökulmasta. Heikki Ruskoaho hallituksen pj Tutkimusta lääkepolitiikan tueksi Kuopio 10.9.2015 Yhteiskunnallinen lääketutkimus Suomen Akatemian näkökulmasta Heikki Ruskoaho hallituksen pj 1 Akatemian tehtävänä on lain mukaan edistää tieteellistä


Raportti 5.11.2007. Syöpäjärjestöjen näkemys HPV-rokotteesta

Raportti 5.11.2007. Syöpäjärjestöjen näkemys HPV-rokotteesta Raportti 5.11.2007 Syöpäjärjestöjen näkemys HPV-rokotteesta Suomen Syöpäyhdistys päätti toukokuussa 2007 perustaa työryhmän valmistelemaan Syöpäjärjestöjen näkemystä HPV-rokotetta koskevista kysymyksistä.



GYNEKOLOGINEN SYÖPÄ 10.5.2016 GYNEKOLOGINEN SYÖPÄ 10.5.2016 kohtusyöpä munasarjasyöpä kohdunkaulasyöpä ulkosynnyttimien syöpä gynekologisten syöpien hoito on HUS-alueella keskitetty NKL:lle KOHTUSYÖPÄ naisten 3. yleisin syöpä; 800-900


BIOMEDICUM HELSINKI. Lääketieteen tutkimus- ja opetuskeskus

BIOMEDICUM HELSINKI. Lääketieteen tutkimus- ja opetuskeskus BIOMEDICUM HELSINKI Lääketieteen tutkimus- ja opetuskeskus SISÄLTÖ Biomedicum Helsinki...4 Tutkimus ja opetus...10 Helsingin yliopisto... 11 HUS / HYKS... 14 Suomen molekyylilääketieteen instituutti...


Terveyden edistämisen mahdollisuudet sote-palveluntuottajan näkökulmasta

Terveyden edistämisen mahdollisuudet sote-palveluntuottajan näkökulmasta Terveyden edistämisen mahdollisuudet sote-palveluntuottajan näkökulmasta Terveyttä edistävä yhteistyö tulevassa sotessa seminaari 19.3.2015 Toimitusjohtaja Aki Lindén 1 Terveyden edistäminen tarkoittaa


Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto

Farmasian tutkimuksen tulevaisuuden näkymiä. Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Farmasian tutkimuksen tulevaisuuden näkymiä Arto Urtti Lääketutkimuksen keskus Farmasian tiedekunta Helsingin yliopisto Auttaako lääkehoito? 10 potilasta 3 saa avun 3 ottaa lääkkeen miten sattuu - ei se


Tutkimusohjelmamuistio (Life 2000)

Tutkimusohjelmamuistio (Life 2000) Tutkimusohjelmamuistio (Life 2000) Biologisten funktioiden tutkimusohjelma Life 2000 Ohjelmamuistio 6.9.1999 SISÄLLYS 1 Johdanto 2 Tutkimusohjelman tavoitteet 3 Tutkimusohjelman teema-alueet A. Neurotieteet



BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy


HPV-epidemiologiasta ja diagnostiikasta

HPV-epidemiologiasta ja diagnostiikasta HPV-epidemiologiasta ja diagnostiikasta Eeva Auvinen dosentti, vs. laboraattori HUSLAB Kliininen mikrobiologia, virologia Labquality 15.10.2004 1 Papilloomavirukset Ihmisillä ja useilla muilla eläinlajeilla,


HÄMEENLINNA, LAMMI tikkaa Järj. Lammin Tikka päivitetty klo 19.30

HÄMEENLINNA, LAMMI tikkaa Järj. Lammin Tikka päivitetty klo 19.30 HÄMEENLINNA, LAMMI 31.1.2016 25 tikkaa Järj. Lammin Tikka päivitetty 31.1.2016 klo 19.30 MM 1. Hyyrynen Juha KLT 41 42 39 41 45 208 2. Rantanen Asko MU 39 44 42 40 42 207 3. Vaarala Simo PaavT 46 35 40


Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto

Syöpägeenit. prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Syöpägeenit prof. Anne Kallioniemi Lääketieteellisen bioteknologian yksikkö Tampereen yliopisto Mitä syöpä on? Ryhmä sairauksia, joille on ominaista: - solukasvun säätelyn häiriö - puutteet solujen erilaistumisessa


2.00,2 Ilmo Siitari ,59 Henri Manninen ,0 Väinö Lestelä ,8 Tapio Nykänen ,8 Erkki Oikarinen -70

2.00,2 Ilmo Siitari ,59 Henri Manninen ,0 Väinö Lestelä ,8 Tapio Nykänen ,8 Erkki Oikarinen -70 100 m: 10,93 Tero Heikkinen -94 11,18 Hannu Hokkanen -84 11,1 Tapani Nykänen -80 11,44 Pasi Tervonen -90 11,2 Kalevi Vauhkonen -70 11,54 Jari Pynnönen -87 11,57 Reijo Erkkilä -84 11,4 Seppo Kupila -56



SUOMALAISEN TIEDEAKATEMIAN VÄISÄLÄN RAHASTON PALKINNOT JA APURAHAT JAETTU 14.12.2015 Lehdistötiedote Julkaisuvapaa 14.12.2015 klo 17.00 SUOMALAISEN TIEDEAKATEMIAN VÄISÄLÄN RAHASTON PALKINNOT JA APURAHAT JAETTU 14.12.2015 Suomalainen Tiedeakatemia myönsi 14.12.2015 pidetyssä tilaisuudessaan



MM MA Kansallinen 25 tikkaa Heinola 14.11.2015 Järj. Heinolan Tikka-kerho MM päivitetty 15.11.2015 klo 18.50 1. Lehtonen Seppo JST 42 44 44 43 43 216 2..2. Miettinen Martti LamTi 45 43 35 41 44 208 3. Tammi


Levinneen suolistosyövän hoito

Levinneen suolistosyövän hoito Levinneen suolistosyövän hoito Yhteyshoitajakoulutus 29.9. LT ylilääkäri Pirkanmaan Syöpäyhdistys Uusien tapausten lukumäärät, yleisimpien syöpien mennyt ja ennustettu trendi, miehet Uusien tapausten lukumäärät,


Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio

Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio Vaikutamme terveysalan kasvuun 12.2.2015, Mikko Alkio Introvertti Seminaarivaiheessa oleva Ongelmakeskeinen Suomi 1 Avautuminen 2 Ikääntyminen on Suomelle ongelma 3 Vaikuttavuus? Lääketutkimus Terveysteknologia


OPETUS- JA KULTTUURIMINISTERIÖ Muistio Liite 2 Opetusneuvos 3.11.2015 Mirja Vihma



Vaalilautakuntien ja vaalitoimikuntien asettaminen eduskuntavaaleja varten. Valmistelija: hallintosihteeri Toini Heinonen, puh.

Vaalilautakuntien ja vaalitoimikuntien asettaminen eduskuntavaaleja varten. Valmistelija: hallintosihteeri Toini Heinonen, puh. Kaupunginhallitus 10 19.01.2015 Vaalilautakuntien ja vaalitoimikuntien asettaminen eduskuntavaaleja varten Kh 10 Valmistelija: hallintosihteeri Toini Heinonen, puh. 02 761 1110 Eduskuntavaalit toimitetaan


Laskennallisten tieteiden tutkijakoulu FICS. Ella Bingham, TKK

Laskennallisten tieteiden tutkijakoulu FICS. Ella Bingham, TKK Laskennallisten tieteiden tutkijakoulu FICS Ella Bingham, TKK Mikä FICS on Kuka minä olen Tutkijakoulun koordinaattori Dosentti, HY tietojenkäsittelytiede TkT, TKK informaatiotekniikka DI, TKK systeemi-


Itä-Häme viikkokilpailu 5 Classic tulokset

Itä-Häme viikkokilpailu 5 Classic tulokset Itä-Häme viikkokilpailu 5 Classic 11.6.-15.6.2016 tulokset 1 SAARINEN, Jari Par 72 10 2 VIINIKAINEN, Jarkko 1 73 8 3 LESKINEN, Jouko 1 73 6 4 TIAINEN, Eetu 2 74 5 5 PULKKINEN, Jari 2 74 4 6 MUTANEN, Jyrki


Herantis Pharma Oyj:n yhtiöesittely Espoo-Kauniaisten osakesäästäjät. Toimitusjohtaja Pekka Simula 19.4.2016

Herantis Pharma Oyj:n yhtiöesittely Espoo-Kauniaisten osakesäästäjät. Toimitusjohtaja Pekka Simula 19.4.2016 Herantis Pharma Oyj:n yhtiöesittely Espoo-Kauniaisten osakesäästäjät Toimitusjohtaja Pekka Simula 19.4.2016 1 Tärkeää tietoa Herantis Pharma Oy ( Yhtiö ) on laatinut tämän esityksen Yhtiöstä vain taustatiedoksi


Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic


Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen

Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Aktivoiva luento-opetus & sillanrakennus kliiniseen opetukseen Opintori 10.5.2012 Minna Männikkö Biolääketieteen laitos Lääketieteellisen biokemian ja molekyylibiologian kurssi 15 op, 170 opiskelijaa Kemia:


Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme?

Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Molekyylibiologia liikuntatutkijan työkaluna Miten liikunta tai liikkumattomuus muokkaa solujamme ja kudoksiamme? Riikka Kivelä, LitT Tutkijatohtori Molekyyli ja syöpäbiologian tutkimusohjelma Lääketieteellinenen


Studia Generalia AINEEN ARVOITUS. Tervetuloa!

Studia Generalia AINEEN ARVOITUS. Tervetuloa! Studia Generalia AINEEN ARVOITUS Tervetuloa! 13.10.2011 1 13.10.2011 AINEEN MONET MAHDOLLISUUDET Lääkeaineita merestä ja metsästä Prof. Jari Yli-Kauhaluoma Uudet materiaalit: molekyylit halki, poikki ja


Rintasyöpä. 12.2.2014 Messukeskus, Helsinki 2014 JO 4. VUOSI! Järjestäjänä: Mediayhteistyössä: TUNNETKO TULEVAISUUDEN HOITOMUODOT?

Rintasyöpä. 12.2.2014 Messukeskus, Helsinki 2014 JO 4. VUOSI! Järjestäjänä: Mediayhteistyössä: TUNNETKO TULEVAISUUDEN HOITOMUODOT? Rintasyöpä 12.2.2014 Messukeskus, Helsinki 2014 TUNNETKO TULEVAISUUDEN HOITOMUODOT? JO 4. VUOSI! 2014 TEEMAT: Tiedätkö tulevat uudet lääkehoidot? Kuule periytyvän rintasyövän geenitestauksesta ja neuvonnasta






KEESHONDIEN MONIMUOTOISUUSKARTOITUS KEESHONDIEN MONIMUOTOISUUSKARTOITUS 2 3. 0 1. 2 0 1 1 K A A R I N A Marjut Ritala DNA-diagnostiikkapalveluja kotieläimille ja lemmikeille Polveutumismääritykset Geenitestit Serologiset testit Kissat, koirat,


Suomen Akatemian rahoitusmuodot SUOMEN AKATEMIA 2016 TUTKIMUSRAHOITUS

Suomen Akatemian rahoitusmuodot SUOMEN AKATEMIA 2016 TUTKIMUSRAHOITUS Suomen Akatemian rahoitusmuodot 1 Suomen Akatemian rahoitusmuodot Akatemiaohjelmat Strategisen tutkimuksen ohjelmat Akatemiaprofessori Tutkimus Akatemiahanke Suunnattu akatemiahanke Tutkijatohtori Tutkijat


5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä



KITEEN PESÄPALLOHISTORIAA 2008 KiU KITEEN PESÄPALLOHISTORIAA 2008 JOUKKUEET: 1920 Luku Kiteenkylän pesäpallojoukkue Hakulinen Heikki Hakulinen Onni Hakulinen Simo Hakulinen Toivo Hakulinen Viljo Hirvonen Arvi Kosonen Juho Lipponen Toivo


Yleisurheiluveteraanien SM-viestit 2012, Turku PN Stadion 9.6.2012 KULTAA

Yleisurheiluveteraanien SM-viestit 2012, Turku PN Stadion 9.6.2012 KULTAA Yleisurheiluveteraanien SM-viestit 2012, Turku PN Stadion 9.6.2012 KULTAA M30 4 x 100 m 1. Varsinais-Suomen Veteraaniurheilijat 47,81 SE Mikko Kiuru Henri Heikkinen Jukka Mertanen Krister Laine M30 4 x


Syövän lääkehoito. Salla Kalsi

Syövän lääkehoito. Salla Kalsi Syövän lääkehoito Salla Kalsi Syöpä Yleisnimitys maligneille (pahanlaatuisille) kasvaimille Karsinogeeninen = syöpää aiheuttava Syövän taustalla voi olla Ympäristötekijät, elintavat, perimä, eräät virus-


Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan

Vastaa lyhyesti selkeällä käsialalla. Vain vastausruudun sisällä olevat tekstit, kuvat jne huomioidaan 1 1) Tunnista molekyylit (1 piste) ja täytä seuraava taulukko (2 pistettä) a) b) c) d) a) Syklinen AMP (camp) (0.25) b) Beta-karoteeni (0.25 p) c) Sakkaroosi (0.25 p) d) -D-Glukopyranoosi (0.25 p) 2 Taulukko.






TERVEYS ALKAA TIEDOSTA NAINEN PIDÄ HUOLTA ITSESTÄSI TERVEYS ALKAA TIEDOSTA NAINEN PIDÄ HUOLTA ITSESTÄSI 1 RINTAOIREET JA RINTOJEN SEURANTA Jokaisen naisen on syytä pitää huolta rintojensa terveydestä. Rintakuvauksiin tullaan yleensä joko oireettomille tehdyn


BIOLOGIA 1. kurssi 7. luokka

BIOLOGIA 1. kurssi 7. luokka 1. kurssi 7. luokka Kurssin tavoitteena on ohjata oppilasta ymmärtämään elämän perusilmiöitä ja vesiekosysteemien rakennetta ja toimintaa. Tavoitteena on, että oppilas oppii tunnistamaan ja luokittelemaan


Immuunipuutokset. Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008

Immuunipuutokset. Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008 Immuunipuutokset Olli Vainio OY Diagnostiikan laitos OYS Kliinisen mikrobiologian laboratorio 17.10.2008 Immuunijärjestelm rjestelmän n toiminta Synnynnäinen immuniteetti (innate) Välitön n vaste (tunneissa)


Mitä teollinen biotekniikka oikein on?

Mitä teollinen biotekniikka oikein on? 1 Mitä teollinen biotekniikka oikein on? Seminaari 17.8.2006 Biotekniikan neuvottelukunta 2 Bioteknologia! Bioteknologia on eliöiden, solujen, solujen osien tai solussa esiintyvien molekyylien toimintojen


Paksusuolisyövän seulontatulokset Suomessa. Nea Malila Suomen Syöpärekisteri

Paksusuolisyövän seulontatulokset Suomessa. Nea Malila Suomen Syöpärekisteri Paksusuolisyövän seulontatulokset Suomessa Suomen Syöpärekisteri Sidonnaisuudet kahden viimeisen vuoden ajalta LT, dosentti Päätoimi Suomen Syöpärekisterin johtaja, Suomen Syöpäyhdistys ry Sivutoimet syöpäepidemiologian


Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm

Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm Geeneistä genomiin, mikä muuttuu? Juha Kere Karolinska Institutet, Stockholm 5 ATCACACACACACAGTCCTGACGTGC 3! 3 TAGTGTGTGTGTGTCAGGACTGCACG 5! Informaatioteknologian mullistus 1978 2013 2048? Molekyylibiologian


Ruoka- ja ravintoaineet 12

Ruoka- ja ravintoaineet 12 Sisällys Johdanto (Anna-Maija Tiainen) 9 1 Ruoka- ja ravintoaineet 12 Energia ja energiaravintoaineet (Senja Arffman) 13 Hiilihydraatit 14 Proteiinit 16 Rasvat 17 omega-3 ja -6 -rasvahapot 19 Alkoholi


Yhteistulokset. Helsingin Siirtolapuutarhojen Aluejärjestö KESÄKISAT 2006 HERTTONIEMI PÖYTÄKIRJA. Siirtolapuutarha. Marjaniemi. Tali.

Yhteistulokset. Helsingin Siirtolapuutarhojen Aluejärjestö KESÄKISAT 2006 HERTTONIEMI PÖYTÄKIRJA. Siirtolapuutarha. Marjaniemi. Tali. Helsingin Siirtolapuutarhojen Aluejärjestö KESÄKISAT PÖYTÄKIRJA Yhteistulokset Lasten viestit Siirtolapuutarha Tulos Kroketti Kuulakikka Mölkky Lentopallo Lausunta Puhe Tikka Petankki Tytöt < v Pojat


Tutkimus- ja kehittämistoiminta Suomessa 2005

Tutkimus- ja kehittämistoiminta Suomessa 2005 Tutkimusrahoitus Tutkimus- ja kehittämistoiminta Suomessa 2005 Tutkimus- ja tuotekehitystehtävissä 77 000 henkilöä Tutkimusrahoitus 5,4 mrd euroa, josta yritysten osuus 70 % T&k-panostus 3,5 % BKT:sta


Savo-Karjalan AM sprintti Liperin Käsämässä tulokset 19.08.2012

Savo-Karjalan AM sprintti Liperin Käsämässä tulokset 19.08.2012 1 Savo-Karjalan AM sprintti Liperin Käsämässä tulokset 19.08.2012 H21 3.0 km (Lähti: 7, Keskeytti: 0, Hylätty: 0) 1. Aaro Asikainen Kalevan Rasti 15.57 2. Santeri Silvennoinen Kalevan Rasti 16.55 +58 3.


9.30 9.40 Avaussanat Osmo Tervonen professori, järjestelytoimikunnan puheenjohtaja

9.30 9.40 Avaussanat Osmo Tervonen professori, järjestelytoimikunnan puheenjohtaja SÄDETURVAPÄIVÄT 29. - 30.10.2015 Torstai 29.10.2015 9.30 9.40 Avaussanat Osmo Tervonen professori, järjestelytoimikunnan puheenjohtaja 9.40 10.10 Carl Wegelius-luento 10.10 11.00 Onnellisuus ja hyvinvointi


Suomen avantouintiliitto SM-Kisat 08.03.2008. A Naiset alle 20 v. Nimi Seura Lähtöaika Rata Aika sija

Suomen avantouintiliitto SM-Kisat 08.03.2008. A Naiset alle 20 v. Nimi Seura Lähtöaika Rata Aika sija A Naiset alle 20 v. Nimi Seura Lähtöaika Rata Aika sija Junila Sandra Tampereen Talviuimarit 13:20 4. 26,53 1 Virta Sini Katismaan Avantouimarit 13:20 2. 32,13 2 B Miehet 20-29 v. Heinämäki Janne Apian


TATI ja trypsinogeenit syöpämerkkiaineina

TATI ja trypsinogeenit syöpämerkkiaineina TATI ja trypsinogeenit syöpämerkkiaineina Annukka Paju FT, dosentti, sairaalakemisti HUSLAB ja Helsingin yliopiston kliinisen kemian laitos SKKY:n kevätkoulutuspäivät 21.4.2009 Ulf-Håkan Stenman -juhlasymposiumi



Sylvant (siltuksimabi) RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO EMA/198014/2014 Sylvant (siltuksimabi) RISKIENHALLINTASUUNNITELMAN JULKINEN YHTEENVETO Tämä on Sylvant-valmistetta koskevan riskienhallintasuunnitelman yhteenveto, jossa esitetään toimenpiteet, joiden


1. Tutkimusstrategian tausta ja tavoite. 2. Tutkimuksen painopisteet ja tukitoimet. Tutkimuksen painopisteet

1. Tutkimusstrategian tausta ja tavoite. 2. Tutkimuksen painopisteet ja tukitoimet. Tutkimuksen painopisteet Tiivistelmä 1. Tutkimusstrategian tausta ja tavoite Hermoston rappeutumissairaudet ovat vahvasti ikääntymiseen liittyviä, terveyttä heikentäviä ja parantumattomia sairauksia. Näistä dementiat aiheuttavat


Lääkealan turvallisuus- ja kehittämiskeskuksen määräys

Lääkealan turvallisuus- ja kehittämiskeskuksen määräys Määräys pp.kk.vvvv Dnro 002646/00.01.00/2014 /2014 Lääkealan turvallisuus- ja kehittämiskeskuksen määräys PITKÄLLE KEHITETYSSÄ TERAPIASSA KÄY- TETTÄVIEN LÄÄKKEIDEN (ATMP) VALMISTA- MINEN YKSITTÄISEN POTILAAN


Suomen Kirjailijaliiton palkinnot ja palkinnon saajat vuosina 1949-2015

Suomen Kirjailijaliiton palkinnot ja palkinnon saajat vuosina 1949-2015 Suomen Kirjailijaliitto r.y. Sivu 1 (6) Suomen Kirjailijaliiton palkinnot ja palkinnon saajat vuosina 1949-2015 Suomen Kirjailijaliiton tunnustuspalkinto Tunnustuspalkinto on annettu vuodesta 1949 lähtien


Opiskelu ja perheellisyys terveyden näkökulmasta. Syntyneet lapset. Yliopisto opiskelijoiden lapset

Opiskelu ja perheellisyys terveyden näkökulmasta. Syntyneet lapset. Yliopisto opiskelijoiden lapset Opiskelu ja perheellisyys terveyden näkökulmasta Aira Virtala Vanhempainilta 091109 Tampereen yliopisto Perhesuunnittelu Haluttu määrä lapsia sopivin välein vanhempien iän huomioiden Ei haluttujen raskauksien


RASTI 1. Pisteytys 14-15.8.-99 PP A B C D PPo ohi E/A Tv Hämeenlinna Hätilä 10 5 4 4 2-20 -10-10 -10

RASTI 1. Pisteytys 14-15.8.-99 PP A B C D PPo ohi E/A Tv Hämeenlinna Hätilä 10 5 4 4 2-20 -10-10 -10 RASTI 1 Suomenmestaruuskilpailu 1999 Pisteytys 14-15.8.-99 PP A B C D PPo ohi E/A Tv Hämeenlinna Hätilä 10 5 4 4 2-20 -10-10 -10 Kilpailijat Pisteet Rangaistukset Aika Ls Tulokset No Nimi Lk. Joukkue PP



NAINEN PIDÄ HUOLTA ITSESTÄSI TERVEYS ALKAA TIEDOSTA NAINEN PIDÄ HUOLTA ITSESTÄSI TERVEYS ALKAA TIEDOSTA 1 RINTAOIREET JA RINTOJEN SEURANTA Nainen huolehdi rintojesi terveydestä. Rintakuvauksiin tullaan yleensä joko oireettomille tehdyn seulontatutkimuksen


Syöpäjärjestöt kuntoutumisen tukena

Syöpäjärjestöt kuntoutumisen tukena Syöpäjärjestöt kuntoutumisen tukena Ylilääkäri, LT, dosentti Suomen Syöpäyhdistys ry SYÖPÄJÄRJESTÖT Syöpäjärjestöillä tarkoitetaan Suomen Syöpäyhdistyksen ja Syöpäsäätiön muodostamaa kokonaisuutta. Suomen


Toimialakohtaisten työryhmien ja alaryhmien jäsenet

Toimialakohtaisten työryhmien ja alaryhmien jäsenet Toimialakohtaisten työryhmien ja alaryhmien jäsenet 1. Sosiaali- ja terveysryhmä Aulis Laaksonen, pj. Pori Terttu Nordman Eija Kuokka Hanna-Leena Markki Harjavalta Jaana Karrimaa Eero Mattsson Pomarkku


TIKKAKISA Henkilökohtainen miehet AKT Kesäpäivät 2013, Kajaani

TIKKAKISA Henkilökohtainen miehet AKT Kesäpäivät 2013, Kajaani TIKKAKISA Henkilökohtainen miehet AKT Kesäpäivät 2013, Kajaani Sijoitus Etunimi Sukunimi Joukkue Tulos 1 Seppo Lehtonen Jokilaakso 104 / 2 40 2 Kai Rimpineva Imatra 002 39 3 Matti Syvälä Tampere 005 36


Liikkuva koululainen investointi kansalliseen hyvinvointiin?

Liikkuva koululainen investointi kansalliseen hyvinvointiin? Pekka Puska Pääjohtaja THL Liikkuva koululainen investointi kansalliseen hyvinvointiin? FTS - Tiedotustilaisuus 17.3.2011 THL suojelee ja edistää suomalaisten terveyttä ja hyvinvointia Kansanterveys suomessa
