BIOYHTEISKUNTA TULEVAISUUS JA HAASTE

Koko: px
Aloita esitys sivulta:

Download "BIOYHTEISKUNTA TULEVAISUUS JA HAASTE"

Transkriptio

1 BIOYHTEISKUNTA TULEVAISUUS JA HAASTE

2 BIOYHTEISKUNTA TULEVAISUUS JA HAASTE Tutkas-seminaari Tilaisuuden avaus Kansanedustaja Jyrki Kasvi Tietoyhteiskunnan jälkeen bio- ja fuusioyhteiskunnat? Kauppatieteiden tohtori Mika Mannermaa, Futures Studies Mannermaa Oy Bioteknologia ja eurooppalaiset vahvuudet yhteisön, yksilön ja tieteen näkökulma Akatemiaprofessori Leena Peltonen-Palotie, Kansanterveyslaitos Biotekniikkayritysten menestystekijät Tutkija Martti, Etla Kahvitauko Elämän suojelu yleistavoitteena Lehtori Mervi Skyttä, Matinkylän koulu, Espoo Kommenttipuheenvuorot Kansanedustaja Pekka Vilkuna, kesk Kansanedustaja Minna Sirnö, vas Kansanedustaja Johanna Karimäki, vihr Keskustelu ja tilaisuuden päätös

3 Kauppatieteiden tohtori Mika Mannermaa, Futures Studies Mannermaa Oy Tietoyhteiskunnan jälkeen bio- ja fuusioyhteiskunnat? Bio- ja fuusio- yhteiskunnat Dos. Mika Mannermaa Futures Studies Mannermaa Oy Muutoksen suuret aallot! Emergenssi! EMERGENSSI uusi vaihe 1. synnyttää Tason nousu uusia aloja, yrityksiä, tuotteita, 2. sisältää edellisten vaiheiden olennaiset piirteet 3. muuntaa edeltäjänsä kaltaisekseen Tiivistyminen Ubiikkiyhteiskunta vs. tietoyhteiskunta Meritokratia Tietoisuusyhteiskunta Dream society Luova talous Ubiikkiyhteiskunta Tietoyhteiskunta = ICT-perusteinen yhteiskunta-aalto aalto Tietoyhteiskunta Tietoyhteiskunta 2 Kolmas aalto + Vuorovaikutusyhteiskunta Oppimisyhteiskunta Uusi talous palveluyhteiskunta

4 Bioyhteiskunta Seuraava teknologia-aalto, aalto, jolla me kaikki ratsastamme, on bioteknologia. Se räjäyttr yttää Alkiodiagnostiikka tajuntamme. Vuoteen 22 rutiiniksi mennessä bioteknologia vrt. selektiiviabortit tuottaa sikiödiagnooseihin ihmisrodulle enemmän perustuen muutoksia kontrolloitu alkionvalinta kuin mitä olemme ja koko kokeneet viimeisten lisääntymistapahtuma miljoonan vuoden aikana Geneettinen Mitä on bioteknologia? parantelu Se on (designer ihmisen teknologiaa, babies) joka jäljittelee j tai muuntelee fyysisten luonnon ominaisuuksien miljoonia vuosia muuntelu kestäneen (koko, nopeus evoluution kuulon, kuluessa näön korjailu täydellistt ydellistämiä biologisia henkisten ominaisuuksien prosesseja. (äly, muisti, musikaalisuus),? --- Schwartz et al 2 Alkiodiagnostiikka Geneettinen nopeus, )? aivovaurioiden korjaus loogis-matemaattisen päättelykyvyn, muistin parantaminen BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Geneettinen seulanta rutiiniksi (biosirut); geenipankit ja -passit? Alttiuksien tunnistaminen (esim. aikuisiän diabetes, alttius sydäntauteihin, ) Hoitoja vaikeisiin tauteihin (perinnölliset taudit,, Parkinson, syövät,, Alzheimer, AIDS, ); geeniterapiat Täsmälääkintä potilaskohtaisuus BIOYHTEISKUNTA trendejä ja heikkoja signaaleja

5 BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Elinikään vaikuttaminen ( 1v. 12v. 15v.?); Kurzweil: 1 v.:n kuluessa kehitetää ään hiiri, joka ei vanhene Ihmisen kloonaus tapahtunee pian, onko yhteiskunnallista merkitystä? miksei samalla paranneltaisi? Suuria henkilökohtaisia kohtaisia, sosiaalisia ja taloudellisia muutoksia yhteiskunnassa BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Geneettisesti muunneltu kasviravinto kultainen riisi (A-vitamiini vitamiini), gm-maissi maissi, -soija, terveysvaikutusten optimointi moninkertainen tuotto/pinta-ala, ala, kasvu vaikeissa olosuhteissa samanaikainen vähäisempi ympäristörasitus Geneettisesti muunnellut eläimet maidon-, lihantuotannon tuottavuuden olennainen kasvu eläinten terveydentilan tarkkailun tehostuminen ja sairauksien ennaltaehkäisyn ja hoidon tehostuminen kloonaus ja sen probleemi lampaat, hiiret, lehmät, apinat Ruokaa +8 miljardille ihmiselle 23? BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Tehostuvat ympäristön monitorointi-, analyysi- ja päätöksentekojärjestelmät Täsmätorjunta-aineet aineet, täsmälannoitteet Bioteknologiset prosessit öljyntuotannossa, muovien valmistuksessa jne. Kierrätys tehostuu Mahdollisuus (ekologisesti) kestävää ään kehitykseen kasvaa: bioyhteiskunta luomuyhteiskunta?

6 Time horizon of a human being I Now Parents Children Grand parents Grand children Time horizon of a human beng I Then Grand parents Parents Children Grand children Grand grand parents Grand grand children FUUSIOYHTEISKUNTA Fuusiokehitys on jo pitkään toteutuneen tieto- ja viestintäteknologian konvergoitumistrendin yleistys Fuusioteknologia: kaikki mahdollinen ihmisen keksimä teknologia sulautetaan yhteen Käyttötarkoitus määrittää, mitkä fuusioteknologian ominaisuudet mekaniikka, tietojenkäsittelyvoima, viestintäkyvyt, bio-,, nano- tai uusien materiaalien ominaisuudet kulloinkin korostuvat Fuusioteknologiasta löytyy kaikki agraariajan elämän teknologia, teollisen aikakauden fyysinen voima ja tehokkuus, tietoajan laskenta- ja viestintäkapasiteetti, bioajan elämän muuntaminen ja myös sellaista, mitä 2-luvun alussa on mahdoton hahmottaa. Kun fuusioteknologiat alkavat vahvasti leimata taloutta, yhteiskuntaa ja arkea, voimme puhua fuusioyhteiskunnasta samassa mielessä kuin nyt tietoyhteiskunnasta

7 Lee M. Silverin visio vai antisellainen? Segregaatio kahteen ryhmää ään n alkoi jo 198-luvulla (USA); vuonna 235: -- bioteknologisesti syrjäytyneetytyneet (luomuihmiset) ja hyväosaiset (eliittigeeniset) -- rodut sulautuneet ihmisiksi, joiden ihonväri vaihtelee liukuvasti ja joiden kasvonpiirteet ilmentävät t merkkejä monista vanhoista roduista -- uusi selkeä ja helposti tunnistettava ero kehittynyt: ihmiset, joilla geneettinen perimä on luonnollinen luonnollinen vs. geneettinen eliitti, jonka geenikarttaa on modifioitu tai laajennettu -- geneettinen eliitti on heterogeeninen; ; erilaisia perheitä tai heimoja: eliittiluonnontieteilijät, t, eliittimuusikot,eliittiurheilijat, -- jakautuvat alaryhmiin: eliittibaseball-pelaajat pelaajat, pikajuoksijat, kuulantyönt ntäjät, t, mäkihyppm kihyppääjät t jne. ala-alaryhm alaryhmät: : hyökk kkääjät t ja puolustajat jääj ääkiekossa Lee M. The Genome of a Human Being and a Chimpanzee are 98% similar

8 Luomut Olympialaiset 3 Voittaja miesten seiväs Janne Persson, Ruotsi: 6,38m Eliittiluokka Voittaja miesten seiväs Zep g. Zapati,, Z-vyöhyke: Z 25,69m Voittaja naisten kiekko Venla Sicinski,, Puola: 75,42m Voittaja naisten kiekko Cor g. Lomi,, Q-vyöhyke: 153,89m Voittaja miesten 1m Jerry Gloom, E-Afrikka: 9,58s Voittaja miesten 1m Ru g. Casqui,, W-vyöhyke: W 4,8127s BIO

9 Akatemiaprofessori Leena Peltonen-Palotie, Kansanterveyslaitos Bioteknologia ja eurooppalaiset vahvuudet yhteisön, yksilön ja tieteen näkökulma Bioteknologia, molekyylilää ääketiede ja eurooppalaiset vahvuudet Leena Palotie Wellcome Trust Sanger Institute, Cambridge,UK Institute of Molecular Medicine, Helsinki The Broad Institute, MIT, Boston, MA,USA Genomiprojektin jälkeen: Koko perimän kattavat menetelmät selvittää terveyden ja sairauden biologia Genomi=Koko perimä Yli 25 lajin perimän emäsjärjestys, perimän tiedosto on löydettävissä tietokannoista (http://www.ncbi.nlm.nih.gov/genome/guide) Näiden joukossa on ihmisen perimän emäsjärjestys

10 Henkilökohtainen geenitiedostomme Noin 19 geenisanaa, 3 miljardia merkkiä (emästä), vastaa kooltaan 8 raamattua Geenisanat samoja kaikilla ihmisillä, yli 3 miljoonaa yksilöllistä kirjainvaihtelua (.1%) Kaikissa kudoksissa ja soluissa sama geenitiedosto, mutta tiedoston osia luetaan vaihdellen elämän eri vaiheissa Tarja Halonen Koko Perimän läpiluenta 21 AACATGGCCGCGGGCTGGAAGTGCGCATGAGCAGCTGTCTATGGAGATACCTAGGCCGGGAGA GGGAGAACACAGTTGGAGAAAATCGGCAGCTGAGACGGCCTTGGCCGGTGAGTGTAGGACCGG GCAGAAGTCTGGAAACTGGGTGGACTGGCAAGGCAGGGCAGCTTTGATTTTGTTTCCGTTTTTC AAGTTAGAGAACACTGCTGGGGAGGAAGCCTTTGTTTTGGGGGAGGGGGCTGTGCTGGTTCTT TATCTCATACCCTGCTTTGTGGGCCAAACTCTCTCCCTTCCCCAGAGCGCGAGCGTCCCAGCCCTC CTGCGCTGTCCAGCTGCGCGCCGCAGCCGCCGGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAG GCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGGGGCGCGGGGCTAAGACTGCGGGGCTGCGGGG TCACGGCGCAGGCTCCCGGGCTCGCGCCTGGCGGGCGCTCAGCTCCGTAAGCGCCTTCTGGTTG GTGAGCCTGCAGGGAGACGCCTCATTCTAAGGCAAGGTCTAGGTGCCTGACTTCTTTCGGGAGT TGATTTTTTTTCCCTTTGTGTCCAGACTTAGCAAGGGCTCTTACTGGGCCCTTCTGGCCTGAGCGT GCACACCACACAGAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCGCAGCCGCC GGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGG GGCGGCGGGGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTCGCGAGGA CCGGGCAGAAGTCTGGAAAC

11 Henkilö 1. Henkilö 2. AACATGGACGCGGGCTGGAAGTGC AACATGGGCGCGGGCTGGAAGTGC Henkilö 1. Henkilö 2. AACATGGATATATATATATGGAAGTGC AACATGGATATA TGGAAGTGC AACATGGCCGCGGGCTGGAAGTGCGCATGAGCAGCTGTCTATGGAGATACCTAGGCCGGGAGA GGGAGAACACAGTTGGAGAAAATCGGCAGCTGAGACGGCCTTGGCCGGTGAGTGTAGGACCGG GCAGAAGTCTGGAAACTGGGTGGACTGGCAAGGCAGGGCAGCTTTGATTTTGTTTCCGTTTTTC AAGTTAGAGAACACTGCTGGGGAGGAAGCCTTTGTTTTGGGGGAGGGGGCTGTGCTGGTTCTT TATCTCATACCCTGCTTTGTGGGCCAAACTCTCTCCCTTCCCCAGAGCGCGAGCGTCCCAGCCCTC CTGCGCTGTCCAGCTGCGCGCCGCAGCCGCCGGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAG GCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGGGGCGCGGGGCTAAGACTGCGGGGCTGCGGGG TCACGGCGCAGGCTCCCGGGCTCGCGCCTGGCGGGCGCTCAGCTCCGTAAGCGCCTTCTGGTTG GTGAGCCTGCAGGGAGACGCCTCATTCTAAGGCAAGGTCTAGGTGCCTGACTTCTTTCGGGAGT TGATTTTTTTTCCCTTTGTGTCCAGACTTAGCAAGGGCTCTTACTGGGCCCTTCTGGCCTGAGCGT GCACACCACACAGAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCGCAGCCGCC GGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGG GGCGGCGGGGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTCGCGAGGA CCGGGCAGAAGTCTGGAAACAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCG CAGCCGCCGGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGA GCAGCTGGGGCGCGGGGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTC GCGCCTGGCGGGCGCTCAGCTCCGTAAGCGCCTTCTGGTTGGTGAGCCTGCAGGGAGACGCCTC ATTCTAAGGCAAGGTCTCCGTTTTTCAAGTTAGAGAACACTGCTGGGGAGGAAGCCTTTGTTTTG GGGGAGGGGGCTGTGCTGGTTCTTTATCTCATACCCTGCTTTGTGGGCCAAACTCTCTCCCTTCC CCAGAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCGCAGCCGCCGGCACCGG Ihmisten välinen geenitekstin ero.1% GCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGGGGCGCGG GGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTCGCGCCTGGCGGGCGCT Miesten ja naisten valinen ero 1.4% CATGTGTCCAGA Perimän kirjaston sisältö Biologisen olemuksemme rakennusohjeisto Ihmiskunnan historian kirja Ihmisen sairauksien perinnöllisen taustan tiedosto

12 Genomin laajuisten analyysien perusteella on mahdollista: Ymmärtää elimistön toimintaa kokonaisuutena, tarkastelemalla muutoksia koko perimässä, perimän luennassa ja geenien yhteistoiminnassa Ymmärtää solujen poikkeavia reaktioita ihmisen sairauksissa uudella tavalla Tautien Genetic genetiikka Traits Simplex Harvinainen or monogenic tauti Complex Monitekijäinen or multifactorial kansantauti Tautigeeni Disease Susceptibility gene Alttiusgeeni Susceptibility Susceptibility gene Alttiusgeeni gene Alttiusgeeni gene Modifying Muokkaava gene geeni Environment Ympäristö Life Elintavat Style etc. Phenotype Tauti Phenotype Tauti Perinnöllinen tauti Monitekijäinen inen tauti Harvinainen Oireet lapsuusiässä Yhden geenin tauti "Mutaatio" Yleinen Oireet aikuisiässä Useita geenejä "DNA vaihtelu"

13 Suomi - Ehkä tautigeeneiltään n maailman parhaiten tunnettu väestv estö Perustajaväestö Sattuma (Drift) Isolaatio Alueellinen väestön kasvu 3 harvinaisen taudin rikastuma Väestörekisterit vuodesta1634 Julkisen terveydenhuollon rekisterit Hyvät kliinikot Väestön myönteinen asenne geenitutkimukseen Suomalaisten alkuperä voidaan tunnistaa genomin analyyseissä Swedes: N.Pedersen

14 Yksittäiset perheet voidaan yhdistää suuriksi muinais-sukupuiksi, joilla yhteinen perustaja Suuri todennäköisyys että suvun potilaat jakavat samat tautigeenit Kansantaudit Geenien vuoropuhelu Ympäristö Proteiinien vuoropuhelu Elintavat Perimän laajuiset analyysit Perimän laajuisten hakujen kauneus: Ei tarvita aiempaa tietoa tai hypoteesia sairauksien taustasta

15 27: Yleisten tautien geeniprofiilit Age-related macular degeneration Alzheimer's disease Amyotrophic Lateral Sclerosis Asthma Atrial fibrillation Bipolar disorder, Breast cancer Coronary artery disease, Crohn's disease, Diabetes, type 1 Diabetes, type 2 Hypertension Celiac disease Colorectal cancer Diabetic nephropathy Gallstone disease Glaucoma Inflammatory bowel disease Ischemic stroke Multiple sclerosis Myocardial infarct Nicotine dependence Obesity Prostate cancer Rheumatoid arthritis, Restless legs syndrome Perimän profiilit piirtyvät esiin: kansantautien riskigeenien tunnistus PPARg IBD5 NOD2 CTLA4 KCNJ11 PTPN22 CD25 IRF5 PCSK9 CFH NOS1AP IFIH1 PCSK9 CFB/C2 LOC q24 IL23R TCF7L2 MEIS1 CDKN2B/ALBXCOR1 8q24 #2BTBD9 8q24 #3C3 8q24 #48q24 8q24 #5ORMDL3 8q24 #64q25 ATG16L1TCF2 5p13GCKR 1q21FTO IRGMC12orf3 NKX2-3ERBB3 IL12BKIAA35 3p21CD226 1q2416p13 PTPN2 PTPN2 TCF2SH2B3 CDKN2B/AFGFR2 IGF2BP2TNRC9 CDKAL1MAP3K1 HHEXLSP1 SLC3A88q24 LOXL1 IL7R TRAF1/C5 STAT4 ABCG8 GALNT2 PSRC1 NCAN TBL2 TRIB1 KCTD1 ANGLPT3 GRIN3A Vaatii massiiviset aineistot ja genominlaajuisten teknologioiden ja laskennallisten analyysien osaamisen keskittymän Sample Intake Genotyping Data Review Data Transfer Follow-up

16 Suuri 12 M Euron EU hanke 24 partneria Suomi koordinoi, 12 eurooppalaisen geeniprofiilit European network for genetic and genomic epidemiology Website: ICELAND ENGAGE EU NORWAY SWEDEN FINLAND ESTONIA PORTUGAL NORTH. IRELAND DENMARK IRELAND UNITED KINGDOM HOLLAND BELGIUM GERMANY SPAIN FRANCE LUXEM- BOURG POLAND LITHUANIA RUSSIA UKRAINE CZECH. REP. SLOVAK REP. MOLDAVIA SWITZERLANDAUSTRIAHUNGARY SLOVENIA ROMANIA CROATIA BOSNIA - HERCEGOVINA JUGOSLAVIA ITALY BULGARIA MACEDONIA ALBANIA GREECE LATVIA BELO RUSSIA RUSSIA KAZAKHSTAN GEORGIA AZERBAIJAN ARMENIA TURKEY HDL, geneettinen alttiusprofiili: 2 kohorttihenkilöä

17 Suuret aineistot antavat mahdollisuuden tunnistaa myös s sukupuolten välisiv lisiä eroja tautialttiuksissa LDL geeniprofiili naiset LDL, geeniprofiili, miehet

18 Mitä hyötyä kansantautien geenitiedosta? Tuottaa uutta tietoa tautien molekyylitason taustasta Jaottelee tautidiagnoosit uudella tavalla, paremmin selvittäen taustalla olevaa biologiaa Hoitovasteen arviointi ja hoidon valinta helpottuu (lääkevaste) Geeniprofiilit selvittävät tautien biologiaa Tulevaisuuden lääketieteen perusta Diagnostiikka Ympäristötekijät, elintavat Uusi diagnostinen luokittelu Molekyylitason tapahtumien ymmärtäminen Uudet hoidon ja ennaltaehkäisyn strategiat Public Health Genomics Ateroskleroosi

19 mg/dl mg/dl LDL cholesterol < >13 Genotype score HDL cholesterol < >13 Genotype Score Yksilön kantamien riski geenien määrä korreloi veren lipidipitoisuuksiin ja infarkti-riskiin per 1-person years Myocardial incidence rate < >13 Genotype Score Naiset Sydäninfarktin riskigeenit Miehet Yksittäiset potilaat tai perheet voidaan yhdistää suuriksi muinaissukupuiksi, joilla yhteinen perustaja Suuri todennäköisyys että suvun potilaat jakavat samat tautigeenit

20 Suomalaiset perheet, joilla poikkeavat veren lipidiarvot: genominlaajuinen Haku löytää kytkin geenin Nature Genetics, 24 Mikä merkitys väestv estötasolla? tasolla? FINRISK kohortit Suomessa Suomen veronmaksajat maksaneet tiedon keräämisen joka viides vuosi: tarkka terveyskartoitus, linkitys terveydenhuollon rekistereihin ja DNA näytteet kerätty FINRISK-92 FINRISK-97 Geenin riskialleeli lisää naisten riskiä sairastua sydän-ja verisuonitauteihin CVD, 2.2 x riski Kuolleisuus: 2.48 x riski Suoja-alleeli suojaa sairastumiselta CVD:.53 x riski Kuolleisuus:.62 x riski

21 Perinnöllisyys vai elintavat? DNA-analyysit Omiikka Uusi Kuolinsyyrekisteri Epidemiologinen tieto ja osaaminen Lääkerekisterit Tautirekisterit Hoitoilmoitusrekisteri Suomen ja Euroopan etulyöntiasema Luotettava terveydenhuolto Korkeatasoinen ja tasa-arvoinen terveydenhuolto Huipputason asiantuntevuus kliinisessä lääketieteessä, genetiikassa, matematiikassa ja epidemiologiassa Hyvä mahdollisuus tautien genomitason tutkimuksiin ja tulosten nopeaan soveltamiseen KANSALLISESSA terveydenhuollossa: hoidossa ja ennaltaehkäisyssä

22 1966 Random samples Kansalliset kohortit the National Biobanks (7 indiv) (12 indiv) (9 5 indiv) (29 indiv) Twins Oulu Birth Cohort -66 Oulu Birth Cohort -86 ATBC Families (6 5 indiv) (35 indiv) Finnrisk -92 Finnrisk -97,2 Health 2 Pohjois-Suomi-kohortti: 1966, 1986 M A C R O S O C I A L E N V T M I C R O S O C I A L E N V I R O N M E N T LIFE COURSE PERSPECTIVE S U B C L I N I C A L C L I N I C A L H E A L T H O U T C O M E S

23 Suuria biopankkeja Estonian Genome project DeCode (Iceland) Carthagen (Canada) UK Biobank Japan Biobank Swedish National Biobank Program (Swegene, Wallenberg Consortium North) Genomeutwin cohorts NIH Prospective cohort based population study Tutkimuskokoelmat vs. diagnostiset näytteet Tutkimustarkoituksiin kerättyjä näytteitä ja niiden tuloksia ei voida käyttää diagnostisessa mielessä! tutkimuslaboratoriot eivät ole diagnostisia laboratorioita tutkittavat eivät ole sitoutuneet ja valmistautuneet siihen, että heidän tietojaan käytetään heidän hoitoonsa, ehkä vasta vuosien päästä saatavien tulosten selkiinnyttyä Suuret geneettisepidemiologiset hankkeet ovat massiivista tilastollista tietojen käsittelyä. Niissä kerättävät geenianalyysien tulokset eivät tarjoa diagnostista informaatiota yksilötasolla

24 DNA-analyysit Omiikka Uusi yhteys Kuolinsyyrekisteri Epidemiologinen tieto ja osaaminen Lääkerekisterit Tautirekisterit Hoitoilmoitusrekisteri Mitä hyötyä kansantautien geenitiedosta? Tuottaa uutta tietoa tautien molekyylitason taustasta Jaottelee tautidiagnoosit uudella tavalla, paremmin selvittäen taustalla olevaa biologiaa Hoitovasteen arviointi ja hoidon valinta helpottuu (lääkevaste) Yksilölliseen riskiarvioon toistaiseksi vain niukka merkitys

25 FIMM International framework Science Health Technology Public-private partnership Molekyylilääketieteen Instituutti (FIMM) Tieteelliset löydökset Tietoa kansanterveyden parantamiseen Uudet teknologiat Teolliset yhteistyöt Vahva kansainvälinen profiili, yhteistyö poikki kolmen ministeriön, teollisuus-yhteydet, hyvät genomitekniikat kansallisina palveluyksikköinä Meilahti campus area FIMM 51

26 Tutkija Martti, Etla Biotekniikkayritysten menestystekijät Biotekniikkayritysten menestystekijät Martti Elinkeinoelämän Tutkimuslaitos ETLA Globaaleja megatrendejä 1. Demografia? Eurooppa: eläke-järjestelmät ja terveydenhuollon kustannukset 2. Fossiilisten polttoaineiden käyttö? saastuminen ja ilmastonmuutos 3. Fossiilisten polttoainevarantojen väheneminen ja keskittyminen? uhka nykyiselle taloudelliselle ja poliittiselle tasapainolle 4. Globalisaatio edennyt kolmanteen vaiheeseensa? T&K toimintoja siirretään kehittyviin talouksiin 5. Teknologinen orientaatio ja digitalisaatio laajenevat kattamaan kaikki elämän osa-alueet Bioteknologia teollisena toimialana Menestystä ei voi suunnitella Potentiaalinen lähde alueelliselle ja kansalliselle talouskehitykselle vahva tuki itsessään muokkaa sektoria Bioteollisuus jäänyt suhteellisen pieneksi

27 United States (1) EU (4) Germany (2,3) United Kingdom (1) Korea (24) (3) Canada (2,3) France (1) Switzerland (24) (1) Belgium (2,3) Israel (22) (3) Sweden (1) Ireland Finland (1) Austria (1) Italy (1) South Africa (22) (2,3) Norway (1) Iceland (3) Poland (24) (2,3) New Zealand (25) (3) Bioteknologian työllisyysvaikutus OECD-maissa (Van Beuzekom ja Arundel 26) Portugal (1) Persons Paikalliset arvoverkot Kansalliset klusterit vientikilpailussa Kuva: Rouvinen -Ylä-Anttila Globalisaatio hajottaa klusterit! Maat/alueet erikoistuvat toiminnoittain, eivät aloittain Kuva: Rouvinen -Ylä-Anttila

28 USAn biotekniikkaklusterit Lähde: The Brookings Insitute Suomen biotekniikkaklusterit Kotimaiset yhteistyöverkostot ja alueellinen erikoistuminen Specialization Drug index development Diagnostics Biomaterials Bioinformatics Enzymes Food and Feed Agroforest Environment R%D services Helsinki Turku Tampere 5 2 Kuopio Oulu 2 4 5

29 Erikoistumisindeksi Specialization Index Specialization index Drug development Diagnostics Biomaterials Bioinformatics Enzymes Food and feed Agroforest Environment R&D services Helsinki Turku Tampere 5 2 Kuopio Oulu Suomen innovaatiotoiminnan haasteet: Suomi innovaatiotoiminnan eturintamassa kiinnikuromisen sijasta rintamaa työnnettävä eteenpäin Radikaalit läpimurtoinnovaatiot Perustutkimus Suomi edelleen alisuorittaja tutkimustulosten kaupallistamisessa voiko/pitäisikö teknologian siirtoa edistää? Menestystä ei voi suunnitella kokeellisuus, yllätyksellisyys Tutkimusjärjestelmä edelleen heikohkosti kansainvälistynyt miten hyödyntää paremmin globaalisti tuotettua tietoa? Määritelmän mukaan vain (globaalisti) paras tutkimus voi työntää eturintamaa Pienen maan pulma: paras voi olla vain harvoilla aloilla strategisten valintojen vaikeus Pekka Ylä-Anttila: Tieteellinen tutkimus ja tutkimusrahoitus innovaatiojärjestelmässä työpaja Suomen Akatemia Suomen asemointi Bioteknologian sovellusalueet Valkoinen Punainen Vihreä Bioinformatiikka Tukiteollisuus Teollisuuden oma näkemys:

30 Lyhyen aikavälin vahvuudet ja heikkoudet Tieteellinen osaaminen Tekes Vahvuus Heikkous Julkisen sektorin tuki Liiketoimintaosaaminen Verkostoituminen Terveydenhuoltojärjestelmä Rahoitusjärjestelmä Sitra -8. % -6. % -4. % -2. %. % 2. % 4. % Pitkän aikavälin mahdollisuudet ja uhat Yleiset tulevaisudennäkymät Rahoitusjärjestelmän kehittyminen Kyky löytää fokus Verkostoituminen, hyötyjen leviäminen Toimialan luonne Julkisen sektorin tuki Koulutus, Tieteellinen osaaminen Ammatimainen johtajuus Julkinen asenne Pieni mittakaava Sitra Mahdollisuus Uhka -3. % -2. % -1. %. % 1. % 2. % 3. % Sweden Switzerland Germany Finland United Kingdom Austria France United States Australia Netherlands Norway Denmark Belgium Portugal(2) Ireland Spain New Zealand Canada(2) Korea Czech Republic Slovak Republic Japan Hungary Italy Turkey Tohtoriopiskelijoiden määrä suhteessa ikäluokkaan ja ulkomaalaisten opisk. osuus Tohtoriopisk. lkmsuhteessa ikäluokkaan,% 1,% 2,% 3,% Switzerland United Kingdom Belgium United States Australia Sweden Denmark (1999) Canada (2) Norway Austria Iceland Spain New Zealand Czech Republic Portugal (2) Finland Turkey(1999) SlovakRepublic Korea Mexico Italy Japan Hungary Italy Turkey Ulkom. tohtoriopiskelijoiden osuus % 2% 4%

31 Globaaleja megatrendejä 1. Demografia? Eurooppa: eläke-järjestelmät ja terveydenhuollon kustannukset 2. Fossiilisten polttoaineiden käyttö? saastuminen ja ilmastonmuutos 3. Fossiilisten polttoainevarantojen väheneminen ja keskittyminen? uhka nykyiselle taloudelliselle ja poliittiselle tasapainolle 4. Globalisaatio edennyt kolmanteen vaiheeseensa? T&K toimintoja siirretään kehittyviin talouksiin 5. Teknologinen orientaatio ja digitalisaatio laajenevat kattamaan kaikki elämän osa-alueet Forestry (4) Devices (9) Other (29) Biomaterials (2) Consultancy Services (9) Food and Feed (45) Diagnostics (46) Agriculture (7) Diagnostic services (27) R&D services (18) Drug development (56) Enzymes (12) Bioinformatics (4) Environment (1) Bioteknologia: tulevaisuuden ala Bioteknologian kehitysajat Average Median Biotekniikka I, Years Hermans & Teollisuustuotanto sektoreittain, vuoden 2 hinnoissa

32 Suomi on siirtynyt lähelle eturintamaa Haasteet: Kiinnikuromisen sijasta pitäisi rintamaa siis työntää eteenpäin Radikaaleilla, läpimurtoinnovaatioilla entistä suurempi merkitys Perustutkimuksen rooli kasvaa Suomi on edelleen (lievä) alisuorittaja tutkimustulosten kaupallistamisessa voiko/pitäisikö teknologian siirtoa edistää? Menestystä ei voi suunnitella kokeellisuus, yllätyksellisyys Tutkimusjärjestelmä on edelleen suhteellisen heikosti kansainvälistynyt miten hyödyntää paremmin globaalisti tuotettua tietoa? määritelmän mukaan vain (globaalisti) paras tutkimus voi työntää eturintamaa Pienen maan pulma: paras voi olla vain harvoilla aloilla strategisten valintojen vaikeus Yhteenveto - johtopäätöksiä Eturintamassa pysymisen ehto on tutkimuksen kansainvälisyys suuretkin maat (USA) hankkivat yhä suuremman osan tiedosta muualta Samanaikaisesti tehtävä valintoja kärkitutkimuksen aloista ja edistettävä tutkimustulosten ja teknologioiden käyttöönottoa: alueellinen erikoistuminen Tiedon ja teknologian siirto yliopistoista: TTO? Bioteknologia perinteisen teollisuuden uudistajana Jo kaupallistamisvaiheessa olevat hankkeet yhteistyössä globaalien jättien kanssa Lisäoptio: Julkinen sektori kestävän kehityksen mahdollistajana Bioteknologia, kestävää kehitystä? Kvartaalitalous vs. kestävä kehitys Pitkät kehitysajat

33 Kestävä kehitys Onko Suomella hyvinvointiyhteiskuntana tuoda kehitykseen lisäarvoa? Osaamispohja hyvä: Tohtoriopiskelijoiden määrä suhteessa ikäluokkaan. Ulkomaisten opiskelijoiden osuus kansianväliset kontaktit! Globaali ajattelutapa! Huom: ei vain markkinat, vaan myös globaalit kilpailijat omalla takapihalla. opettajia Suomeen opiskelijoita ulkomaille Huom! Suomen osuus globaaleista tutkimusmenoista Huom! Globalisoituminen Suomen etu Bioteknologian pk-yritykset ja niiden henkilöstö Yhtiöiden Henkilöstö Alue lukumäärä yhteensä keskimäärin Helsinki Turku Tampere Kuopio Oulu Muut Yhteensä

34 Strateginen viitekehys Teknologinen merkitt ävyys Ainutlaatuiset Unique tuotannontekijät factors of japroduction -rakenteet Alueellinen erikoistuminen 2. Kysyntäohjautuva kaupallistamisstrategia Poikkitieteellisten osaamisperustojen hyödyntäminen 3. Kansainvälisesti kilpailukykyiset teolliset tukialat Taloudellinen arvo 4. Vaativa Domestic market markkinalaboratorio laboratory Teollinen klusteroituminen Jakelukananvat ja partnerit Globaalit markkinat National targets for R&D spending Lähde: OECD Science, Technology and Industry Outlook 26 Globalisaatio ja bioteknologia Halpatuotantoilmiön sijaan syntynyt runsaasti pieniä kilpailevia teknologiakeskuksia ympäri maailman

35 Alueet/maat erikoistuvat toiminnoittain Maa 1 Maa N Yritys 1 Yritys N Kuva: Rouvinen -Ylä-Anttila Porterin timanttimalli Climate for for Innovation- Based Local Rivalry Factor (Input) Conditions Demand Conditions Clusters of of Related and Supporting Industries Bioteknisen P&kteollisuuden kansainväliset yhteistyöverkot

36 Lehtori Mervi Skyttä, Matinkylän koulu, Espoo Elämän suojelu yleistavoitteena: Ympäristönsuojelusta elämänsuojeluun Bioyhteiskunta edellyttää paradigman muutoksen Johdannoksi: Mitä elämä on? Elämä on maapallon pintaosien kaikki kolkat kattava prosessi, geneettiseen informaatioon perustuva kerrostunut rakennelma, jossa edellinen taso ennustaa seuraavan mahdollisuudet. Elämä on eliöissä, ja niistä muodostuva biodiversiteetti on kaiken elämäkeskustelun perusta. Informaatio puolestaan on punoutunut makromolekyyliin, orgaaniseen aineeseen, jonka nimi on DNA. Puhumme tuttavallisesti geeneistä. Ihmisen DNA on samaa kuin muillakin eliöillä, olivatpa ne eläimiä, sieniä, kasveja tai mikrobeja. Ei ole pääsääntöisesti erikseen ihmisen geenejä. Esimerkkinä mainittakoon Suomessa parhaillaan tehtävä tutkimus, jossa taltioidaan lemmikkikoirien DNA:ta ihmisen tautigeenien tunnistamiseksi. Elämä on ilmiö, jossa geneettinen informaatio pyörittää energian turvin valtaisaa ainemäärää. Elämän monimuotoisuuden synty puolestaan on seurausta luonnon äärimmäisestä energia- ja materiaalitehokkuudesta. Energia virtaa ja aine kiertää kaikessa luonnollisessa tuotannossa, kulutuksessa ja hajotuksessa. Tässä Elämän kaavassa ihminen on luonnostaan kuluttaja. Eliökunnan satoja miljoonia vuosia kestäneen historian kuluessa informaatio, RNA:na ja DNA:na, on muovautunut kaikiksi niiksi lukemattomiksi elämänmuodoiksi, jotka maapallolla joskus ovat eläneet, kuten myös miljooniksi eliölajeiksi, jotka nykyään elävät maapallolla. Mikäli avaruusolennot jotenkin päätyisivät maapalloa tutkimaan, he kyllä toteaisivat, että täällä vallitsee elämä. Biodiversiteetistä pääteltäisiin elämän kehittyneisyyden aste ja sen laadun mukaan arvioitaisiin elämän vakautta ja tulevaisuutta. Mikä olisi ihmisen sija? Varmaankin hankala sivuosa, sillä elämän omat mahdollisuudet ovat lopulta sen moninaisuuden varassa. Tieteellinen tieto elämästä moninkertaistuu lyhyessä ajassa. Tiedon sisältö sen merkityksestä puhumattakaan ei ennätä riittävästi karttua kansalaisten osaamispääomaksi. Ennakkoluulot ovat joskus hyödyllisiä, mutta kohtuuton epäily tiedon sovellusten suhteen kielii, että biologian osalta sivistystä ei ole saavutettu. Elämän kokonaisuuden oivaltaminen vaatii enemmän aikaa, kuin mitä sen opiskeluun kansalaisten koulujärjestelmässä on suotu. Mediakriittisyydestä ei voida uneksiakaan, ellei ihmisten päässä ole riittävää asiasisältöä, faktaa. Kansalaistiedon puute johtaa pahimmillaan meritokratiaan, joka ei istu demokraattiseen järjestelmään. Tämä ihmisen ympäristö vuoden 27 lehtikuvan kertomana Vuoden 27 lehtikuvaan Helsingin Sanomien valokuvaaja Hannes Heikura naulitsi kaksi liikettä, veneen ja veden. On jo signaali sinänsä, että tällainen aihe vene kyntämässä Itämeren sinileväpuuroa oli voittoisa. Lukuisista hankkeista huolimatta Itämeren kunto pysyy huonona vielä pitkään. Meren tila kielii suuren populaation elintasosta ja kulttuurisista tavoista; kansojen ruokailusta, hygieniasta ja tuotantotaloudesta. Katsotaan asiaa suomalaisittain, keskitytään ruokaan. Sen hinta on pyhä käsite, ruoka ei saa maksaa! Jotta ruuan tuottaja hankkisi elantonsa siinä missä muutkin palkansaajat, hänen on koko ajan pystyttävä myymään samalta alalta suurempi sato. Osa tuotannon kiihdytysmateriaalista valuu tuotantosyklin ohi kuormittamaan vesistöjä. Pitää kuitenkin muistaa, että ravinteiden valtavirta kulkeutuu pellolta rehuksi ja usean portaan kautta ruokapöytiin. Edelleen ei sovi unohtaa, että ketju ei pysähdy vielä pöytäänkään. Leväkukinnot suorastaan huutavat, että virtsan, sonnan ja muunkin likaliemen valunta Itämereen on saanut jatkua turhan pitkään. Tuskin kukaan on tietämätön sen suhteen, että ravinnevuoto mereen on vastenmielisen ilmiön perimmäinen syy. Asiain tila onneksi on muuttumassa, joskaan sataprosenttista puhdistusta ei pitkään aikaan saavuteta. Mutta miten muuttuisi rantojen asukkaiden asenne suhteessa yhdessä luotuun elintasoon? Eikö jokaisen

Elämää PISA:n varjossa

Elämää PISA:n varjossa Professor Markku Niemivirta, PhD, Docent Institute of Behavioural Sciences University of Helsinki, Finland Elämää PISA:n varjossa Tasapainottelua menestyksen ja hyvinvoinnin välissä? PISA 2000 Finland

Lisätiedot

Nuorten työttömyys -faktaa ja fiktiota

Nuorten työttömyys -faktaa ja fiktiota Nuorten työttömyys -faktaa ja fiktiota Ulla Hämäläinen Johtava tutkija Sosiaaliturvan ABC toimittajille 31.5.2012 Nuorten työttömyysaste Euroopassa Työttömyysaste ikäryhmittäin Suomessa 1995-2011 % 40

Lisätiedot

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013

Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 Suomalainen genomitieto ja yksilöllistetty terveydenhuolto Olli Kallioniemi October 9, 2013 FIMM - Institiute for Molecular Medicine Finland Terveyden ylläpito vauvasta vanhuuteen Elintavat Taudit Terve

Lisätiedot

Sisällys. 1. Energiatehokkuudesta. 2. Energiatehokkuusindikaattorit kansantalouden makrotasolla

Sisällys. 1. Energiatehokkuudesta. 2. Energiatehokkuusindikaattorit kansantalouden makrotasolla Sisällys 1. Energiatehokkuudesta. Energiatehokkuusindikaattorit kansantalouden makrotasolla 3. Hiilidioksidipäästöihin vaikuttavia tekijöitä dekompositioanalyysi 4. Päätelmiä Energiatehokkuudesta Energiatehokkuuden

Lisätiedot

Suomen biokapasiteetti ja sen. Prof. Jyri Seppälä Suomen ympäristökeskus

Suomen biokapasiteetti ja sen. Prof. Jyri Seppälä Suomen ympäristökeskus Suomen biokapasiteetti ja sen kestävä ä käyttö Prof. Jyri Seppälä Suomen ympäristökeskus Suomen kestävän kehityksen toimikunta 4 / 2010 Suomen ekologisen jalanjäljen ja biokapasiteetin kehitys Lähde: Global

Lisätiedot

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä

Lisätiedot

Osaaminen, innovaatiot ja vihreä teknologia

Osaaminen, innovaatiot ja vihreä teknologia Osaaminen, innovaatiot ja vihreä teknologia Elias Einiö Valtion taloudellinen tutkimuskeskus VATT VATT päivä 2.10.2013 Päästöjä vähennetään 1990=100 Kasvihuonekaasujen päästöt, Suomi 140 120 100 80 Tavoite

Lisätiedot

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen

Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen Kansanterveyslaitoksen bioteknologiastrategia Väestöaineistojen käyttöön liittyviä haasteita Juhani Eskola 310505 7.6.2005 1 Valitut painopistealueet Kansantautien ja terveyden geenitausta Mikrobit ja

Lisätiedot

Suomi osaamisen kärjessä 2030 Olli Luukkainen Educa 24.1.2014

Suomi osaamisen kärjessä 2030 Olli Luukkainen Educa 24.1.2014 Suomi osaamisen kärjessä 2030 Olli Luukkainen Educa 24.1.2014 1 OAJ:n tulevaisuustyö Suomessa on tehty suuria: Kansakoulu Yliopistot Peruskoulu Ammatillinen koulutus Ammattikorkeakoulut Vapaa sivistystyö

Lisätiedot

Lihavuuden kustannuksia. Markku Pekurinen, osastojohtaja, tutkimusprofessori

Lihavuuden kustannuksia. Markku Pekurinen, osastojohtaja, tutkimusprofessori Lihavuuden kustannuksia Markku Pekurinen, osastojohtaja, tutkimusprofessori Lihavuus Monien sairauksien riskitekijä Väestötasolla nopeasti yleistyvä ongelma Taloudellisista vaikutuksista lisääntyvästi

Lisätiedot

Kuinka ammattirakenteet mukautuvat globaaleihin arvoketjuihin

Kuinka ammattirakenteet mukautuvat globaaleihin arvoketjuihin Kuinka ammattirakenteet mukautuvat globaaleihin arvoketjuihin Mika Maliranta (ETLA & Jyväskylän yliopisto) Maakunnan yhteistyöryhmän tulevaisuusfoorumi, osa 2, Jyväskylä, 10.5.2011 THE RESEARCH INSTITUTE

Lisätiedot

Nuorisotyöttömyys Euroopassa. Eurooppafoorumi: Työläisten Eurooppa, Tampere, 6.9.2013 Liisa Larja (liisa.larja@stat.fi)

Nuorisotyöttömyys Euroopassa. Eurooppafoorumi: Työläisten Eurooppa, Tampere, 6.9.2013 Liisa Larja (liisa.larja@stat.fi) Nuorisotyöttömyys Euroopassa Eurooppafoorumi: Työläisten Eurooppa, Tampere, 6.9.2013 Liisa Larja (liisa.larja@stat.fi) 2 Talouskriisin vaikutus nuorisotyöttömyyteen (15-24 v.) 25,0 20,0 15,0 23,3 20,1

Lisätiedot

Kunta- ja palvelurakenne Kanta-Hämeessä. Jouko Isolauri 26.9.2013

Kunta- ja palvelurakenne Kanta-Hämeessä. Jouko Isolauri 26.9.2013 Kunta- ja palvelurakenne Kanta-Hämeessä Jouko Isolauri 26.9.2013 Sen jälkeen kun kuntien valtionosuuksia on edelleen leikattu 500 me toimintaa tehostettu toisella 500 me:lla velvoitteita kevennetty niin,

Lisätiedot

Metsien luonnontuotteet ja luomu. Rainer Peltola, MTT Rovaniemi / LAPPI LUO

Metsien luonnontuotteet ja luomu. Rainer Peltola, MTT Rovaniemi / LAPPI LUO Metsien luonnontuotteet ja luomu Rainer Peltola, MTT Rovaniemi / LAPPI LUO Keruuluomu / luomukeruu Luonnonmarjat ja -sienet ovat luomua, jos ne on kerätty erikseen määritellyiltä luomukeruualueilta Keruualueeksi

Lisätiedot

Projektikokemuksia pk-yrityshankkeista

Projektikokemuksia pk-yrityshankkeista Projektikokemuksia pk-yrityshankkeista Jari Uotila VTT Research for SMEs ohjelman hakemuskoulutus 05.09.2012 2 Miksi PK-yritys mukaan EU-hankkeisiin Vähäriskinen tapa aloittaa kansainvälistyminen Uusien

Lisätiedot

MEKIN UUDET HAASTEET. Keski-Suomen matkailuparlamentti Jyväskylä 29.11.2006. Pirkko Perheentupa Matkailun edistämiskeskus

MEKIN UUDET HAASTEET. Keski-Suomen matkailuparlamentti Jyväskylä 29.11.2006. Pirkko Perheentupa Matkailun edistämiskeskus MEKIN UUDET HAASTEET Keski-Suomen matkailuparlamentti Jyväskylä 29.11.2006 Pirkko Perheentupa Matkailun edistämiskeskus MEKin uudet tehtävät 2007 Yhtenäistää ja selkeyttää Suomen matkailullista kokonaiskuvaa

Lisätiedot

Tuottavuuskehitys pkyrityksissä

Tuottavuuskehitys pkyrityksissä Tuottavuuskehitys pkyrityksissä Mika Maliranta (ETLA & Jyväskylän yliopiston kauppakorkeakoulu) Talouskasvua pk-yritysten tuottavuutta kehittämällä, TEM, 20.10.2010 1 Johtopäätökset (1/2) Kasvupolitiikka

Lisätiedot

Väestöennuste 2012 mikä muuttui?

Väestöennuste 2012 mikä muuttui? mikä muuttui? Markus Rapo, Tilastokeskus Rakenteet murroksessa pohjoinen näkökulma 29.11.2012, Oulu Esityksessäni Havaittu väestökehitys Tilastokeskuksen väestöennuste luonne ja tulkinta oletukset (vs.

Lisätiedot

Suomi innovaatioympäristönä maailman paras?

Suomi innovaatioympäristönä maailman paras? Suomi innovaatioympäristönä maailman paras? Pekka Ylä-Anttila 20.1.2011 Maailman paras? Evaluation of the Finnish National Innovation System (syksy 2009) Suomessa on edelleen hyvä ja toimiva innovaatiojärjestelmä,

Lisätiedot

Hyvinvointiyhteiskunta. mahdollinen yhtälö 1.1 5.2.2003

Hyvinvointiyhteiskunta. mahdollinen yhtälö 1.1 5.2.2003 1. HYVINVOINTIYHTEISKUNTA MAHDOLLINEN YHTÄLÖ BKT:n vuosimuutos 1988 21... 1.2 T&K-panosten osuus bruttokansantuotteesta... 1.3 T&K-toiminnan osuus BKT:sta eräissä maissa... 1.4 T&K-henkilöstön osuus työssäkäyvistä

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Esityksessäni 10/26/2015. Naiset ja miehet ikääntyvässä Suomessa Markus Rapo, Tilastokeskus. -Vanhus / ikääntynyt määritelmä?

Esityksessäni 10/26/2015. Naiset ja miehet ikääntyvässä Suomessa Markus Rapo, Tilastokeskus. -Vanhus / ikääntynyt määritelmä? Naiset ja miehet ikääntyvässä Suomessa Markus Rapo, Tilastokeskus VANHUUS JA SUKUPUOLI Kasvun ja vanhenemisen tutkijat ry:n, Ikäinstituutin ja Gerontologian tutkimuskeskuksen yhteisseminaari 2.1.215, Tieteiden

Lisätiedot

Maksujärjestelmäsimulaattori SUOMEN PANKKI FINLANDS BANK BANK OF FINLAND

Maksujärjestelmäsimulaattori SUOMEN PANKKI FINLANDS BANK BANK OF FINLAND Maksujärjestelmäsimulaattori 10.12.2013 Tatu Laine Sisältö Maksutapahtuma maksujärjestelmässä BoF-PSS2 simulaattorin historia Maksujärjestelmän simulointi Kysymyksiä, joihin maksujärjestelmäsimulaattori

Lisätiedot

Anna Rotkirch Väestöntutkimuslaitos, Väestöliitto @perhetutkimus www.vaestoliitto.fi www.vaestoliitonblogi.com

Anna Rotkirch Väestöntutkimuslaitos, Väestöliitto @perhetutkimus www.vaestoliitto.fi www.vaestoliitonblogi.com Anna Rotkirch Väestöntutkimuslaitos, Väestöliitto @perhetutkimus www.vaestoliitto.fi www.vaestoliitonblogi.com OKM avustus ja Väestöntutkimuslaitos Väestöliitto Väestöntutkimuslaitos Perhebarometri 2014:

Lisätiedot

Mäntyöljykyllästys vaihtoehto kreosootille?

Mäntyöljykyllästys vaihtoehto kreosootille? 28.5.2014 1 Mäntyöljykyllästys vaihtoehto kreosootille? Lieksan Puuakatemia seminaari Puun käytön laaja-alaistaminen Janne Monni, vtj, Iivari Mononen Oy 20.-21.5.2014 Lieksa 28.5.2014 2 Esityksen sisältö

Lisätiedot

Maatalous ja tuotantoeläinten hyvinvointi. Jukka Markkanen MTK 30.9.2010

Maatalous ja tuotantoeläinten hyvinvointi. Jukka Markkanen MTK 30.9.2010 Maatalous ja tuotantoeläinten hyvinvointi Jukka Markkanen MTK 30.9.2010 2 MTK:n organisaatio 2010 3 Kansallinen politiikka -liikkumavara -kohdentaminen Kansallinen politiikka -liikkumavara -kohdentaminen

Lisätiedot

Tilastokeskuksen väestöennuste Kuolevuuslaskelmat. Markus Rapo, Tilastokeskus

Tilastokeskuksen väestöennuste Kuolevuuslaskelmat. Markus Rapo, Tilastokeskus Tilastokeskuksen väestöennuste Kuolevuuslaskelmat Markus Rapo, Tilastokeskus Esityksessäni Hieman historiaa ja taustaa Tilastokeskuksen väestöennuste luonne ja tulkinta Kuolleisuuslaskelmat Tilastokeskuksen

Lisätiedot

Porvoon matkailun tunnuslukuja huhtikuu 2012

Porvoon matkailun tunnuslukuja huhtikuu 2012 Porvoon matkailun tunnuslukuja huhtikuu 2012 Yöpymiset + 12,5 % tammi-huhtikuussa Porvoon majoitusliikkeiden rekisteröidyt yöpymiset (33.900) lisääntyivät tammi-huhtikuussa 12,5 % edellisvuodesta. Kasvua

Lisätiedot

4. KORKEA VEROTUS VIE MITALISIJAN HYVINVOINTIKILPAILUSSA

4. KORKEA VEROTUS VIE MITALISIJAN HYVINVOINTIKILPAILUSSA 4. KORKEA VEROTUS VIE MITALISIJAN HYVINVOINTIKILPAILUSSA Bruttoveroaste Suomessa... 4.2 Efektiivinen tuloveroaste eräissä maissa 21... 4.3 Tuloveroprosentit tulotasoittain 22... 4.4 Tuloveroprosentit 22

Lisätiedot

Korkeakoulutettujen työllistyminen ja työmarkkinoiden muutokset

Korkeakoulutettujen työllistyminen ja työmarkkinoiden muutokset Korkeakoulutettujen työllistyminen ja työmarkkinoiden muutokset Osaamista ohjaukseen koulutuspäivä 13.3.2015, Lahti Heikki Taulu ekonomisti Akava 25 20 15 10 5 0 Työttömyysaste Suomessa, Euroopassa ja

Lisätiedot

Maatalouden energiankulutus Suomessa ja Euroopassa

Maatalouden energiankulutus Suomessa ja Euroopassa Ainutlaatuinen energiaseminaari Hämeenlinna 11.12.2013 Maatalouden energiankulutus Suomessa ja Euroopassa Hannu Mikkola Helsingin yliopisto Maataloustieteiden laitos 12.12.2013 1 Maatilan energiankulutus

Lisätiedot

Korkeasti koulutettujen työllisyys

Korkeasti koulutettujen työllisyys Korkeasti koulutettujen työllisyys Heikki Taulu ekonomisti Akava Tulevaisuuden tekijät -seminaari Käsitteet selviksi Työikäinen väestö = kaikki Suomessa asuvat 1 74 -vuotiaat Työvoima = työikäiseen väestöön

Lisätiedot

Osaaminen ja innovatiivisuus kilpailukyvyn perusta. Juha Ylä-Jääski 21.9.2006

Osaaminen ja innovatiivisuus kilpailukyvyn perusta. Juha Ylä-Jääski 21.9.2006 Osaaminen ja innovatiivisuus kilpailukyvyn perusta Juha Ylä-Jääski 21.9.26 Teknologiateollisuus - Suomen tärkein elinkeino 6 % Suomen koko viennistä 66 % Suomen koko elinkeinoelämän t&k-investoinneista

Lisätiedot

Suomi ja suomalaiset yritykset globaalitaloudessa keiden kanssa kilpailemme tulevaisuudessa?

Suomi ja suomalaiset yritykset globaalitaloudessa keiden kanssa kilpailemme tulevaisuudessa? Suomi ja suomalaiset yritykset globaalitaloudessa keiden kanssa kilpailemme tulevaisuudessa? Pekka Ylä-Anttila ETLA ja Etlatieto Oy ELKOM 07 - ECT Forum 5.9.07 Esityksen teemat Mitä maailmantaloudessa

Lisätiedot

Pandemia, -vaste ja jälkiviisaus

Pandemia, -vaste ja jälkiviisaus Kuolleiden lukumaara 7.5.2010 H1N1 pandemic 2009 Pandemia, -vaste ja jälkiviisaus Pasi Penttinen, European Centre for Disease Prevention and Control 22 April 2010, Helsinki, Suomi Virallisesti ilmoitetut

Lisätiedot

Porvoon matkailun tunnuslukuja Marraskuu 2012

Porvoon matkailun tunnuslukuja Marraskuu 2012 Porvoon matkailun tunnuslukuja Marraskuu 2012 Yöpymiset + 0,4 % tammi-marraskuussa Porvoon majoitusliikkeiden rekisteröidyt yöpymiset (116.500) lisääntyivät tammi-marraskuussa 0,4 % edellisvuodesta. Kasvua

Lisätiedot

Merkittävää eriarvoisuutta WHO-Koululaistutkimuksen tuloksia nuorten terveydestä ja hyvinvoinnista

Merkittävää eriarvoisuutta WHO-Koululaistutkimuksen tuloksia nuorten terveydestä ja hyvinvoinnista SOSIAALILÄÄKETIETEEN PÄIVÄT 28.11.2012 Nuoret ja huono-osaisuus Merkittävää eriarvoisuutta WHO-Koululaistutkimuksen tuloksia nuorten terveydestä ja hyvinvoinnista Kristiina Ojala Jyväskylän yliopisto WHO-Koululaistutkimus

Lisätiedot

Suomalaiset vahvuudet

Suomalaiset vahvuudet Suomalaiset vahvuudet Korkealaatuinen terveydenhuoltojärjestelmä Luotettavat terveydenhuollon rekisterit Väestöaineistot ja terveydenhuollon näytekokoelmat Geneettisesti homogeeninen väestö Kansainvälisesti

Lisätiedot

Kuntien talous ja sote-uudistus. Olli Savela, kaupunginvaltuutettu, Hyvinkää 28.9.2014 Helsinki

Kuntien talous ja sote-uudistus. Olli Savela, kaupunginvaltuutettu, Hyvinkää 28.9.2014 Helsinki Kuntien talous ja sote-uudistus Olli Savela, kaupunginvaltuutettu, Hyvinkää 28.9.2014 Helsinki 1 Sote-alueiden rahoitus Kunnat rahoittavat sote-alueiden toiminnan painotetun asukasluvun perusteella, painotekijöinä

Lisätiedot

Onko biotaloudessa Suomen tulevaisuus? Anu Kaukovirta-Norja, Vice President, Bio and Process Technology VTT

Onko biotaloudessa Suomen tulevaisuus? Anu Kaukovirta-Norja, Vice President, Bio and Process Technology VTT Onko biotaloudessa Suomen tulevaisuus? Anu Kaukovirta-Norja, Vice President, Bio and Process Technology VTT 2 Maapallo kohtaa haasteet - kestävän kehityksen avaimet Vähähiilisyys Niukkaresurssisuus Puhtaat

Lisätiedot

Kansainvälinen aikuistutkimus, PIAAC 2008 2013

Kansainvälinen aikuistutkimus, PIAAC 2008 2013 Kansainvälinen aikuistutkimus, PIAAC 2008 2013 Ensituloksia Suomen kannalta Työelämä 2020 kv-verkosto, 6.3.2014 Maija Lyly-Yrjänäinen, TEM Tuomo Alasoini, Tekes Tutkimushankkeen taustoja OECD:n koordinoima

Lisätiedot

KOTKAN-HAMINAN SEUTU. MATKAILUN TUNNUSLUKUJA 13.6.2013 Huhtikuu. Kotka venäläisyöpymisissä Jonsuun ja Jyväskylän. Alkuvuoden yöpymiset + 11 %

KOTKAN-HAMINAN SEUTU. MATKAILUN TUNNUSLUKUJA 13.6.2013 Huhtikuu. Kotka venäläisyöpymisissä Jonsuun ja Jyväskylän. Alkuvuoden yöpymiset + 11 % KOTKAN-HAMINAN SEUTU MATKAILUN TUNNUSLUKUJA 13.6.2013 Huhtikuu Alkuvuoden yöpymiset + 11 % Kotkan-Haminan seudun majoitusliikkeiden rekisteröidyt yöpymiset (40.800) lisääntyivät tammi-huhtikuussa 11,4

Lisätiedot

Kaikki myyntilaskut sähköisenä yhden operaattorin kautta. Merja Hauskamaa, ISS Palvelut, Taloushallinto

Kaikki myyntilaskut sähköisenä yhden operaattorin kautta. Merja Hauskamaa, ISS Palvelut, Taloushallinto Kaikki myyntilaskut sähköisenä yhden operaattorin kautta Merja Hauskamaa, ISS Palvelut, Taloushallinto ISS Suomessa ja maailmalla Maailmalla Perustettu 1901 Tanskassa Toimimme 53 maassa Työllistämme 534

Lisätiedot

EU:n koulutusraportti: Koulutustavoitteisiin pääseminen edellyttää vieläkin lisätoimia

EU:n koulutusraportti: Koulutustavoitteisiin pääseminen edellyttää vieläkin lisätoimia IP/11/488 Bryssel 19. huhtikuuta 2011 EU:n koulutusraportti: Koulutustavoitteisiin pääseminen edellyttää vieläkin lisätoimia EU-maat ovat viime vuosikymmenen aikana kehittäneet koulutusjärjestelmiään keskeisillä

Lisätiedot

Markkinaraportti / heinäkuu 2010

Markkinaraportti / heinäkuu 2010 Markkinaraportti / heinäkuu 21 Yöpymismäärissä merkittävää kasvua heinäkuussa Yöpymiset Helsingin majoitusliikkeissä lisääntyivät heinäkuussa 18,2 % edellisvuoden heinäkuusta. Lisäystä tuli sekä kotimaasta

Lisätiedot

Case Arla: Luomu meillä ja maailmalla. Nnenna Liljeroos 1.10.2014

Case Arla: Luomu meillä ja maailmalla. Nnenna Liljeroos 1.10.2014 Case Arla: Luomu meillä ja maailmalla Nnenna Liljeroos 1.10.2014 Arla on kansainvälinen ja paikallinen meijerialan suunnannäyttäjä. Kannustamme ihmisiä ympäri maailman elämään terveellisesti tarjoamalla

Lisätiedot

Markkinaraportti / lokakuu 2010

Markkinaraportti / lokakuu 2010 Markkinaraportti / lokakuu 21 Yöpymiset lisääntyivät lokakuussa Sekä kotimaasta että ulkomailta saapuneiden yöpymisten määrä jatkoi kasvuaan Helsingissä myös lokakuussa. Erityisen voimakkaasti lisääntyivät

Lisätiedot

OSAAMISEN EVOLUUTIO SOPRANO OYJ

OSAAMISEN EVOLUUTIO SOPRANO OYJ OSAAMISEN EVOLUUTIO SOPRANO OYJ Koulutus, konsultointi ja kansainvälistyminen Soprano Oyj Arto Tenhunen CEO SOPRANON KASVUTARINA PERUSTETTU 1984 - Kansainvälisen kaupan konsulttitoimisto SOPRANO 1996 -

Lisätiedot

Markkinaraportti / tammikuu 2011

Markkinaraportti / tammikuu 2011 Markkinaraportti / tammikuu 211 Yöpymiset lisääntyivät tammikuussa 9 % Matkailu vilkastui Helsingissä yöpymisissä mitattuna tammikuussa 211 sekä koti- että vientimarkkinoilla. Nousua kirjattiin sekä vapaa-ajan

Lisätiedot

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä

Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Arvokkaiden yhdisteiden tuottaminen kasveissa ja kasvisoluviljelmissä Siirtogeenisiä organismeja käytetään jo nyt monien yleisten biologisten lääkeaineiden valmistuksessa. Esimerkiksi sellaisia yksinkertaisia

Lisätiedot

Tulevaisuuden haasteet puunkorjuuteknologialle 5 väittämää

Tulevaisuuden haasteet puunkorjuuteknologialle 5 väittämää Tulevaisuuden haasteet puunkorjuuteknologialle 5 väittämää Professori Antti Asikainen Metsäntutkimuslaitos Joensuun tutkimuskeskus METSÄALAN TULEVAISUUSFOORUMI Tulevaisuusseminaari 2 Tampere, 1.6. 2004

Lisätiedot

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Peittyvä periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Peittyvä periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

VANTAA Matkailun tunnuslukuja

VANTAA Matkailun tunnuslukuja VANTAA Matkailun tunnuslukuja Kesäkuu 212 www.vantaa.fi/yrityspalvelut Yöpymiset ulkomailta kesäkuussa + 8 % Vantaan majoitusliikkeiden rekisteröidyt yöpymiset (72.3) lisääntyivät kesäkuussa edellisvuodesta

Lisätiedot

INNOVAATIOPOLITIIKAN MUUTOSTRENDIT MIKSI JA MITEN? Johtaja Timo Kekkonen, Innovaatioympäristö ja osaaminen, Elinkeinoelämän Keskusliitto EK

INNOVAATIOPOLITIIKAN MUUTOSTRENDIT MIKSI JA MITEN? Johtaja Timo Kekkonen, Innovaatioympäristö ja osaaminen, Elinkeinoelämän Keskusliitto EK INNOVAATIOPOLITIIKAN MUUTOSTRENDIT MIKSI JA MITEN? Johtaja Timo Kekkonen, Innovaatioympäristö ja osaaminen, Elinkeinoelämän Keskusliitto EK Mikä on innovaatio innovaatiostrategia innovaatiopolitiikka???

Lisätiedot

Ilmailijan lääketiede. Uudet medikaalivaatimukset. Helsinki Fly In, 17.8.2013 Jukka Terttunen, AME Liikennelääketiedeyksikkö. Yhteinen asia.

Ilmailijan lääketiede. Uudet medikaalivaatimukset. Helsinki Fly In, 17.8.2013 Jukka Terttunen, AME Liikennelääketiedeyksikkö. Yhteinen asia. Ilmailijan lääketiede Uudet medikaalivaatimukset Helsinki Fly In, 17.8.2013 Jukka Terttunen, AME Liikennelääketiedeyksikkö Vastuullinen liikenne Vastuullinen liikenne. Yhteinen asia. Fit to fly? Lääketieteellinen

Lisätiedot

Porvoon matkailun tunnuslukuja tammikuu 2012

Porvoon matkailun tunnuslukuja tammikuu 2012 Porvoon matkailun tunnuslukuja tammikuu 2012 Yöpymiset + 31 % tammikuussa Porvoon majoitusliikkeiden rekisteröidyt yöpymiset (3.600) lisääntyivät tammikuussa 30,7 % vuoden 2011 tammikuuhun verrattuna.

Lisätiedot

Terveys ja hyvinvointi

Terveys ja hyvinvointi Terveys ja hyvinvointi 1. Henkilökohtainen lääketiede/personalized medicine 2. Hoitojen yksilöillistyminen (personalized medicine) ja julkinen terveydenhuolto 3. Personalized nutrition, in particular the

Lisätiedot

Alihankinta 2014 -messut Teema koneenrakentaminen. 18.9.2014 Petri Katajamäki ja Pekka Lappalainen

Alihankinta 2014 -messut Teema koneenrakentaminen. 18.9.2014 Petri Katajamäki ja Pekka Lappalainen Alihankinta 2014 -messut Teema koneenrakentaminen 18.9.2014 Petri Katajamäki ja Pekka Lappalainen DEMOGRAFIA Lähde: Statista 2013 Koko 357 092 km2 (1,05 x Suomi) 82,4 miljoonaa asukasta (15,8 x Suomi)

Lisätiedot

Sirpa Rajalin. tutkijaseminaari

Sirpa Rajalin. tutkijaseminaari Sirpa Rajalin 35. Liikenneturvallisuusalan tutkijaseminaari Helsingissä 20.5.2010 2010 Tieliikenteessä kuolleet 100 000 asukasta kohden eräissä maissa 2008 0 5 10 15 20 25 Islanti Iceland Malta Malta

Lisätiedot

Miten luodaan kestävän kehityksen hyvinvointia kaikille?

Miten luodaan kestävän kehityksen hyvinvointia kaikille? Miten luodaan kestävän kehityksen hyvinvointia kaikille? Maailman Alzheimer -päivän muistiseminaari 20.9.2013 Seminaarin teema: Välitä Timo Järvensivu, KTT, tutkija Aalto-yliopiston kauppakorkeakoulu KESTÄVÄ

Lisätiedot

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet?

Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Kymmenen kärjessä mitkä ovat suomalaisten yleisimmät perinnölliset sairaudet? Harvinaiset-seminaari TYKS 29.9.2011 Jaakko Ignatius TYKS, Perinnöllisyyspoliklinikka Miksi Harvinaiset-seminaarissa puhutaan

Lisätiedot

Kansaianvälinen aikuistutkimus PIAAC 2012

Kansaianvälinen aikuistutkimus PIAAC 2012 1 AIKUISKOULUTUS MARGINAALISTA KESKIÖÖN KVS140-Juhlavuoden seminaari Helsinki 21.3.2014 Kansaianvälinen aikuistutkimus PIAAC 2012 Antero Malin Koulutuksen tutkimuslaitos Jyväskylän yliopisto 2 Kansainvälinen

Lisätiedot

Globaalin talouden murros. Leena Mörttinen 22.1.2015

Globaalin talouden murros. Leena Mörttinen 22.1.2015 Globaalin talouden murros Leena Mörttinen 22.1.2015 Globaalin talouden murros: kolme näkökulmaa 1. Teollisuuden murros: uudet teknologiat sekä tuhoavat että luovat uutta 2. Politiikan murros: poliittiset

Lisätiedot

Lentoliikenteen taloudellinen merkitys Suomelle

Lentoliikenteen taloudellinen merkitys Suomelle Lentoliikenteen taloudellinen merkitys Suomelle Oxford Economics yhteenveto Helsinki 2012 To represent, lead and serve the airline industry Lentoliikenne : Taloudellisen kasvun perusta On kustannustehokasta

Lisätiedot

Mitä teollinen biotekniikka oikein on?

Mitä teollinen biotekniikka oikein on? 1 Mitä teollinen biotekniikka oikein on? Seminaari 17.8.2006 Biotekniikan neuvottelukunta 2 Bioteknologia! Bioteknologia on eliöiden, solujen, solujen osien tai solussa esiintyvien molekyylien toimintojen

Lisätiedot

Eurooppa, me ja koulutuksen tulevaisuus

Eurooppa, me ja koulutuksen tulevaisuus Eurooppa, me ja koulutuksen tulevaisuus Jyrki J.J. Kasvi eduskunta, tulevaisuusvaliokunta 24.11. 2009 www.kasvi.org 1 EU on vapaata liikkuvuutta Sisämarkkinoiden neljä vapautta: pääomien, tavaroiden, palveluiden

Lisätiedot

Tilastokeskuksen asiakasaamu kirjastoille ja tietopalveluille 3.12.2009. Kansainväliset hintavertailut Harri Kananoja

Tilastokeskuksen asiakasaamu kirjastoille ja tietopalveluille 3.12.2009. Kansainväliset hintavertailut Harri Kananoja Tilastokeskuksen asiakasaamu kirjastoille ja tietopalveluille 3.12.2009 Kansainväliset hintavertailut Harri Kananoja KANSAINVÄLINEN HINTAVERTAILU = OSTOVOIMAPARITEETTIOHJELMA 1. Mihin ostovoimapariteetteja

Lisätiedot

uusia päämääriä Rio+20 Lisää tähän ja otsikko kestävä kehitys tuloksia ja Johtaja Tellervo Kylä-Harakka-Ruonala, EK

uusia päämääriä Rio+20 Lisää tähän ja otsikko kestävä kehitys tuloksia ja Johtaja Tellervo Kylä-Harakka-Ruonala, EK Rio+20 Lisää tähän ja otsikko kestävä kehitys tuloksia ja uusia päämääriä Johtaja, EK Säteilevät Naiset seminaari Rion ympäristö- ja kehityskonferenssi 1992 Suurten lukujen tapahtuma 180 valtiota, 120

Lisätiedot

Suomen mahdollisuudet innovaatiovetoisessa kasvussa

Suomen mahdollisuudet innovaatiovetoisessa kasvussa Suomen mahdollisuudet innovaatiovetoisessa kasvussa 1. Mitkä ovat kasvun tyylilajit yleensä? 2. Globalisaatio haastaa rikkaat maat; olemme siis hyvässä seurassa 3. Kasvu tulee tuottavuudesta; mistä tuottavuus

Lisätiedot

Maailmantalouden tulevaisuusnäkymät ja Suomen asema maailmassa: markat takas vai miten tästä selvitään? Nuoran seminaari 29.3. 2012 Mikko Kosonen

Maailmantalouden tulevaisuusnäkymät ja Suomen asema maailmassa: markat takas vai miten tästä selvitään? Nuoran seminaari 29.3. 2012 Mikko Kosonen Maailmantalouden tulevaisuusnäkymät ja Suomen asema maailmassa: markat takas vai miten tästä selvitään? Nuoran seminaari 29.3. 2012 Mikko Kosonen Sitran trendilista 1. Ennakoimattomien tapahtumien tiheys

Lisätiedot

Markkinaraportti / elokuu 2015

Markkinaraportti / elokuu 2015 Markkinaraportti / elokuu 2015 Yöpymiset yli 6 % nousussa Yöpymiset lisääntyivät Helsingissä elokuussa yli 6 % vuoden takaisesta. Yöpymismäärä, 407.100, oli kaikkien aikojen elokuun ennätys. Kotimaasta

Lisätiedot

Talouskasvua ja materiaalivirtaa vai kohtuutta. Eija Koski Pääkaupunkiseudun Kierrätyskeskus Oy

Talouskasvua ja materiaalivirtaa vai kohtuutta. Eija Koski Pääkaupunkiseudun Kierrätyskeskus Oy Talouskasvua ja materiaalivirtaa vai kohtuutta Eija Koski Pääkaupunkiseudun Kierrätyskeskus Oy Ranskalainen arvoitus: Vesihyasintti Huomaat lammessa vesihyasintin Sen määrä kaksinkertaistuu joka päivä

Lisätiedot

Porvoon matkailun tunnuslukuja Lokakuu 2012

Porvoon matkailun tunnuslukuja Lokakuu 2012 Porvoon matkailun tunnuslukuja Lokakuu 2012 Yöpymiset + 0,4 % tammi-lokakuussa Porvoon majoitusliikkeiden rekisteröidyt yöpymiset (107.600) lisääntyivät tammi-lokakuussa 0,4 % edellisvuodesta. Kasvua tuli

Lisätiedot

verkkovierailu Karri Huhtanen Arch Red Oy

verkkovierailu Karri Huhtanen Arch Red Oy verkkovierailu Karri Huhtanen Arch Red Oy 33 maata mukana, Funet mukana alusta asti * Austria (ACONet) * Belgium (BELNET) * Bulgaria (BREN) * Croatia (CARNet) * Cyprus (CYNET) * Czech Republic (CESNET)

Lisätiedot

Väestölaskennat Suomessa ja maailmalla

Väestölaskennat Suomessa ja maailmalla Väestölaskennat Suomessa ja maailmalla Tilastokeskuspäivä 26.1.2011 Jari Tarkoma Väestölaskentojen historiaa Suomessa (1) 1800-luvun jälkipuolella yhteiskunnan tietotarve lisääntyi mm. kaupungistumisen

Lisätiedot

EU tutkimusrahoitus PK-yrityksille

EU tutkimusrahoitus PK-yrityksille EU tutkimusrahoitus PK-yrityksille Jari Uotila VTT Biotalouskonversion uudet yhteistyö- ja liiketoimintamahdollisuudet puupohjaiset materiaalit ja prosessit 14.06.2012 Jyväskylä 2 EU 7. Puiteohjelma (FP7)

Lisätiedot

ZA4880. Flash Eurobarometer 239 (Young people and science) Country Specific Questionnaire Finland

ZA4880. Flash Eurobarometer 239 (Young people and science) Country Specific Questionnaire Finland ZA4880 Flash Eurobarometer 239 (Young people and science) Country Specific Questionnaire Finland FLASH 239 YOUNG PEOPLE AND SCIENCE D1. Sukupuoli [ÄLÄ KYSY - MERKITSE SOPIVIN] Mies...1 Nainen...2 D2. Minkä

Lisätiedot

Market Report / December

Market Report / December Market Report / December Nights in Helsinki down 6% in December while the total 212 numbers stayed the same as last year Nights in Helsinki were down 6.1% in December. Domestic nights declined by 8.5%,

Lisätiedot

Rakentamisen suhdannekatsaus

Rakentamisen suhdannekatsaus Rakentamisen suhdannekatsaus Asuminen ja rakentaminen - suhdanteet muuttuvat? Tilastokeskus 29.5.28 Tilastopäällikkö Jukka Oikarinen Rakentamisen osuus bruttokansantuotteesta, 1976 26* Construction as

Lisätiedot

Tuhkarokko- ja sikotautiepidemoita Euroopassa

Tuhkarokko- ja sikotautiepidemoita Euroopassa Tuhkarokko- ja sikotautiepidemoita Euroopassa Labqualityn neuvottelukokous 17.10.2008 Irja Davidkin Tuhkarokko ja sikotauti virusten aiheuttamia lastentauteja, jotka ennen rokotuksia esiintyivät epidemioina

Lisätiedot

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com

Vallitseva periytyminen. Potilasopas. Kuvat: Rebecca J Kent www.rebeccajkent.com rebecca@rebeccajkent.com 12 Vallitseva periytyminen Muokattu allamainittujen instanssien julkaisemista vihkosista, heidän laatustandardiensa mukaan: Guy's and St Thomas' Hospital, London, United Kingdom; and the London IDEAS Genetic

Lisätiedot

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä

Lisätiedot

BIOLOGIA -kurssien suoritusjärjestys on vapaa -oppiaineen hyväksytty suoritus edellyttää hyväksyttyä suoritusta kursseista 1 tai 2 ja 3 tai 4.

BIOLOGIA -kurssien suoritusjärjestys on vapaa -oppiaineen hyväksytty suoritus edellyttää hyväksyttyä suoritusta kursseista 1 tai 2 ja 3 tai 4. BIOLOGIA -kurssien suoritusjärjestys on vapaa -oppiaineen hyväksytty suoritus edellyttää hyväksyttyä suoritusta kursseista 1 tai 2 ja 3 tai 4. KURSSI 1 (1 vvt) käyttämään biologialle ominaisia käsitteitä

Lisätiedot

aineksina Esitelmän pääpiirteet

aineksina Esitelmän pääpiirteet Osaaminen ja oppiminen innovaatioiden ja hyvinvoinnin aineksina Kansainvälisiä suuntaviivoja tulevaisuuteen Kiira Kärkkäinen Project Director FCG International Osaaminen ja oppiminen innovaatioiden ja

Lisätiedot

Sosiaalisesti ja kulttuurisesti kestävä kehitys suhteessa ekologisesti ja taloudellisesti kestävään kehitykseen

Sosiaalisesti ja kulttuurisesti kestävä kehitys suhteessa ekologisesti ja taloudellisesti kestävään kehitykseen Sosiaalisesti ja kulttuurisesti kestävä kehitys suhteessa ekologisesti ja taloudellisesti kestävään kehitykseen Prof. Mauri Åhlbergin kommenttipuheenvuoro Kestävä kehitys, hyvä ympäristö ja hyvä elämä

Lisätiedot

SAMAPALKKAISUUTEEN PALKKAUSJÄRJESTELMÄUUDISTUKSIN Markku Palokangas, Toimihenkilöunioni Minna Etu-Seppälä, Suomen Varustamoyhdistys

SAMAPALKKAISUUTEEN PALKKAUSJÄRJESTELMÄUUDISTUKSIN Markku Palokangas, Toimihenkilöunioni Minna Etu-Seppälä, Suomen Varustamoyhdistys SAMAPALKKAISUUTEEN PALKKAUSJÄRJESTELMÄUUDISTUKSIN Markku Palokangas, Toimihenkilöunioni Minna Etu-Seppälä, Suomen Varustamoyhdistys Toimihenkilöiden työsuhdepäivä, 1.- 3.2.2007, Silja Symphony 1 SUKUPUOLTEN

Lisätiedot

Tilastokeskuksen väestöennusteet

Tilastokeskuksen väestöennusteet Tilastokeskuksen väestöennusteet Kymppi-Moni hankkeen 2. työpaja Markus Rapo, Väestö- ja kuolemansyytilastot Tilastokeskus Esityksessäni Hieman historiaa Miksi ennusteita laaditaan Tilastokeskuksen väestöennusteen

Lisätiedot

Liikkuva koululainen investointi kansalliseen hyvinvointiin?

Liikkuva koululainen investointi kansalliseen hyvinvointiin? Pekka Puska Pääjohtaja THL Liikkuva koululainen investointi kansalliseen hyvinvointiin? FTS - Tiedotustilaisuus 17.3.2011 THL suojelee ja edistää suomalaisten terveyttä ja hyvinvointia Kansanterveys suomessa

Lisätiedot

Sonera Avoin Kuitu Alueellisia valokuituverkkoja ja valinnanvapautta pientaloalueille

Sonera Avoin Kuitu Alueellisia valokuituverkkoja ja valinnanvapautta pientaloalueille Sonera Avoin Kuitu Alueellisia valokuituverkkoja ja valinnanvapautta pientaloalueille Syysseminaari, Turku 4.11.2015 Markus Näkki, Development Manager, Sonera Operator Business 1. Miten valokuitua koko

Lisätiedot

Jätämme maapallon lapsillemme vähintään samanlaisena kuin meillä se on nyt

Jätämme maapallon lapsillemme vähintään samanlaisena kuin meillä se on nyt Jätämme maapallon lapsillemme vähintään samanlaisena kuin meillä se on nyt 1. Emme tuhlaa luonnonvaroja ja saastuta ympäristöä - tasapaino luonnon käytön ja suojelun välillä 2. Huolehdimme ihmisten hyvinvoinnista

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

Suomi teknologiapohjaisten hyvinvointipalvelujen globaalina edelläkävijänä? 9.12.2009 Mikko Kosonen

Suomi teknologiapohjaisten hyvinvointipalvelujen globaalina edelläkävijänä? 9.12.2009 Mikko Kosonen Suomi teknologiapohjaisten hyvinvointipalvelujen globaalina edelläkävijänä? 9.12.2009 Mikko Kosonen Lähtökohtana hyvinvoinnin ja talouden tasapainoinen kehittäminen Edistyksellinen teollisuus- ja innovaatiopolitiikka

Lisätiedot

Tekstiviestejä ilman rajoja : komissio aikoo tehdä lopun ulkomailla lähetettyjen tekstiviestien kohtuuttomista verkkovierailuhinnoista

Tekstiviestejä ilman rajoja : komissio aikoo tehdä lopun ulkomailla lähetettyjen tekstiviestien kohtuuttomista verkkovierailuhinnoista IP/08/1144 Bryssel 15. heinäkuuta 2008 Tekstiviestejä ilman rajoja : komissio aikoo tehdä lopun ulkomailla lähetettyjen tekstiviestien kohtuuttomista verkkovierailuhinnoista Ulkomaisessa verkossa vierailevien

Lisätiedot

VIHREÄ IDEOLOGIA SOLIDARITEETTIA KÄYTÄNNÖSSÄ Lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta

VIHREÄ IDEOLOGIA SOLIDARITEETTIA KÄYTÄNNÖSSÄ Lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta VIHREÄ IDEOLOGIA SOLIDARITEETTIA KÄYTÄNNÖSSÄ Lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta Tämä teksti on lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta. Kun puolueohjelma

Lisätiedot

Kylä yrittäjän ja yrittäjä kylän toiminnan tukena. Yrittäjä Tiina Ekholm 8.6.2013 Tykköö

Kylä yrittäjän ja yrittäjä kylän toiminnan tukena. Yrittäjä Tiina Ekholm 8.6.2013 Tykköö Kylä yrittäjän ja yrittäjä kylän toiminnan tukena. Yrittäjä Tiina Ekholm 8.6.2013 Tykköö Kylätoiminta on kylän asukkaiden vapaaehtoista yhteistyötä omien elinolojensa kehittämiseksi. Elintärkeää on yhteistyö:

Lisätiedot

Talouden näkymät ja suomalaisen kilpailukyvyn ja hyvinvoinnin turvaaminen

Talouden näkymät ja suomalaisen kilpailukyvyn ja hyvinvoinnin turvaaminen Talouden näkymät ja suomalaisen kilpailukyvyn ja hyvinvoinnin turvaaminen Korkeakoulujen ja tiedelaitosten johdon seminaari 28.11.2012 Tuire Santamäki-Vuori valtiosihteeri Talouskehitys lyhyellä aikavälillä

Lisätiedot

Porvoon matkailun tunnuslukuja heinäkuu 2012

Porvoon matkailun tunnuslukuja heinäkuu 2012 Porvoon matkailun tunnuslukuja heinäkuu 2012 Yöpymiset + 4 % tammi-heinäkuussa Porvoon majoitusliikkeiden rekisteröidyt yöpymiset (72.400) lisääntyivät tammi-heinäkuussa 3,9 % edellisvuodesta. Kasvua tuli

Lisätiedot

Pankkisektori Suomessa

Pankkisektori Suomessa Pankkisektori Suomessa 18.9.2015 Pauli Kariniemi Talousvaliokunnan kuuleminen Rahoitusmarkkinaosasto/Pankki- ja rahoitusyksikkö Sisältö Tilannekuva Sääntelyn ajankohtaiskatsaus Mitä tavoitellaan? Mitä

Lisätiedot

kultakolikko.fi - kultakolikkotaulukko 2011-07

kultakolikko.fi - kultakolikkotaulukko 2011-07 Maa Nimellisarvo Lyönti- Kolikon paino Kulta- vuosi pitoisuus unssia Suomi 10 Markkaa 1879-1913 3,2258 0,9000 0,0933 2,903 (Finland) 20 Markkaa 1878-1913 6,4516 0,9000 0,1867 5,806 100 Markkaa 1926 4,2105

Lisätiedot

Biopankki: ideasta käytäntöön

Biopankki: ideasta käytäntöön Biopankki: ideasta käytäntöön Kimmo Pitkänen Kehittämispäällikkö Suomen molekyylilääketieteen instituutti FIMM European Biotech Week, Biomedicum 2.10.2013 FIMM - Institute for Molecular Medicine Finland

Lisätiedot