BIOYHTEISKUNTA TULEVAISUUS JA HAASTE

Koko: px
Aloita esitys sivulta:

Download "BIOYHTEISKUNTA TULEVAISUUS JA HAASTE"

Transkriptio

1 BIOYHTEISKUNTA TULEVAISUUS JA HAASTE

2 BIOYHTEISKUNTA TULEVAISUUS JA HAASTE Tutkas-seminaari Tilaisuuden avaus Kansanedustaja Jyrki Kasvi Tietoyhteiskunnan jälkeen bio- ja fuusioyhteiskunnat? Kauppatieteiden tohtori Mika Mannermaa, Futures Studies Mannermaa Oy Bioteknologia ja eurooppalaiset vahvuudet yhteisön, yksilön ja tieteen näkökulma Akatemiaprofessori Leena Peltonen-Palotie, Kansanterveyslaitos Biotekniikkayritysten menestystekijät Tutkija Martti, Etla Kahvitauko Elämän suojelu yleistavoitteena Lehtori Mervi Skyttä, Matinkylän koulu, Espoo Kommenttipuheenvuorot Kansanedustaja Pekka Vilkuna, kesk Kansanedustaja Minna Sirnö, vas Kansanedustaja Johanna Karimäki, vihr Keskustelu ja tilaisuuden päätös

3 Kauppatieteiden tohtori Mika Mannermaa, Futures Studies Mannermaa Oy Tietoyhteiskunnan jälkeen bio- ja fuusioyhteiskunnat? Bio- ja fuusio- yhteiskunnat Dos. Mika Mannermaa Futures Studies Mannermaa Oy Muutoksen suuret aallot! Emergenssi! EMERGENSSI uusi vaihe 1. synnyttää Tason nousu uusia aloja, yrityksiä, tuotteita, 2. sisältää edellisten vaiheiden olennaiset piirteet 3. muuntaa edeltäjänsä kaltaisekseen Tiivistyminen Ubiikkiyhteiskunta vs. tietoyhteiskunta Meritokratia Tietoisuusyhteiskunta Dream society Luova talous Ubiikkiyhteiskunta Tietoyhteiskunta = ICT-perusteinen yhteiskunta-aalto aalto Tietoyhteiskunta Tietoyhteiskunta 2 Kolmas aalto + Vuorovaikutusyhteiskunta Oppimisyhteiskunta Uusi talous palveluyhteiskunta

4 Bioyhteiskunta Seuraava teknologia-aalto, aalto, jolla me kaikki ratsastamme, on bioteknologia. Se räjäyttr yttää Alkiodiagnostiikka tajuntamme. Vuoteen 22 rutiiniksi mennessä bioteknologia vrt. selektiiviabortit tuottaa sikiödiagnooseihin ihmisrodulle enemmän perustuen muutoksia kontrolloitu alkionvalinta kuin mitä olemme ja koko kokeneet viimeisten lisääntymistapahtuma miljoonan vuoden aikana Geneettinen Mitä on bioteknologia? parantelu Se on (designer ihmisen teknologiaa, babies) joka jäljittelee j tai muuntelee fyysisten luonnon ominaisuuksien miljoonia vuosia muuntelu kestäneen (koko, nopeus evoluution kuulon, kuluessa näön korjailu täydellistt ydellistämiä biologisia henkisten ominaisuuksien prosesseja. (äly, muisti, musikaalisuus),? --- Schwartz et al 2 Alkiodiagnostiikka Geneettinen nopeus, )? aivovaurioiden korjaus loogis-matemaattisen päättelykyvyn, muistin parantaminen BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Geneettinen seulanta rutiiniksi (biosirut); geenipankit ja -passit? Alttiuksien tunnistaminen (esim. aikuisiän diabetes, alttius sydäntauteihin, ) Hoitoja vaikeisiin tauteihin (perinnölliset taudit,, Parkinson, syövät,, Alzheimer, AIDS, ); geeniterapiat Täsmälääkintä potilaskohtaisuus BIOYHTEISKUNTA trendejä ja heikkoja signaaleja

5 BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Elinikään vaikuttaminen ( 1v. 12v. 15v.?); Kurzweil: 1 v.:n kuluessa kehitetää ään hiiri, joka ei vanhene Ihmisen kloonaus tapahtunee pian, onko yhteiskunnallista merkitystä? miksei samalla paranneltaisi? Suuria henkilökohtaisia kohtaisia, sosiaalisia ja taloudellisia muutoksia yhteiskunnassa BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Geneettisesti muunneltu kasviravinto kultainen riisi (A-vitamiini vitamiini), gm-maissi maissi, -soija, terveysvaikutusten optimointi moninkertainen tuotto/pinta-ala, ala, kasvu vaikeissa olosuhteissa samanaikainen vähäisempi ympäristörasitus Geneettisesti muunnellut eläimet maidon-, lihantuotannon tuottavuuden olennainen kasvu eläinten terveydentilan tarkkailun tehostuminen ja sairauksien ennaltaehkäisyn ja hoidon tehostuminen kloonaus ja sen probleemi lampaat, hiiret, lehmät, apinat Ruokaa +8 miljardille ihmiselle 23? BIOYHTEISKUNTA trendejä ja heikkoja signaaleja Tehostuvat ympäristön monitorointi-, analyysi- ja päätöksentekojärjestelmät Täsmätorjunta-aineet aineet, täsmälannoitteet Bioteknologiset prosessit öljyntuotannossa, muovien valmistuksessa jne. Kierrätys tehostuu Mahdollisuus (ekologisesti) kestävää ään kehitykseen kasvaa: bioyhteiskunta luomuyhteiskunta?

6 Time horizon of a human being I Now Parents Children Grand parents Grand children Time horizon of a human beng I Then Grand parents Parents Children Grand children Grand grand parents Grand grand children FUUSIOYHTEISKUNTA Fuusiokehitys on jo pitkään toteutuneen tieto- ja viestintäteknologian konvergoitumistrendin yleistys Fuusioteknologia: kaikki mahdollinen ihmisen keksimä teknologia sulautetaan yhteen Käyttötarkoitus määrittää, mitkä fuusioteknologian ominaisuudet mekaniikka, tietojenkäsittelyvoima, viestintäkyvyt, bio-,, nano- tai uusien materiaalien ominaisuudet kulloinkin korostuvat Fuusioteknologiasta löytyy kaikki agraariajan elämän teknologia, teollisen aikakauden fyysinen voima ja tehokkuus, tietoajan laskenta- ja viestintäkapasiteetti, bioajan elämän muuntaminen ja myös sellaista, mitä 2-luvun alussa on mahdoton hahmottaa. Kun fuusioteknologiat alkavat vahvasti leimata taloutta, yhteiskuntaa ja arkea, voimme puhua fuusioyhteiskunnasta samassa mielessä kuin nyt tietoyhteiskunnasta

7 Lee M. Silverin visio vai antisellainen? Segregaatio kahteen ryhmää ään n alkoi jo 198-luvulla (USA); vuonna 235: -- bioteknologisesti syrjäytyneetytyneet (luomuihmiset) ja hyväosaiset (eliittigeeniset) -- rodut sulautuneet ihmisiksi, joiden ihonväri vaihtelee liukuvasti ja joiden kasvonpiirteet ilmentävät t merkkejä monista vanhoista roduista -- uusi selkeä ja helposti tunnistettava ero kehittynyt: ihmiset, joilla geneettinen perimä on luonnollinen luonnollinen vs. geneettinen eliitti, jonka geenikarttaa on modifioitu tai laajennettu -- geneettinen eliitti on heterogeeninen; ; erilaisia perheitä tai heimoja: eliittiluonnontieteilijät, t, eliittimuusikot,eliittiurheilijat, -- jakautuvat alaryhmiin: eliittibaseball-pelaajat pelaajat, pikajuoksijat, kuulantyönt ntäjät, t, mäkihyppm kihyppääjät t jne. ala-alaryhm alaryhmät: : hyökk kkääjät t ja puolustajat jääj ääkiekossa Lee M. The Genome of a Human Being and a Chimpanzee are 98% similar

8 Luomut Olympialaiset 3 Voittaja miesten seiväs Janne Persson, Ruotsi: 6,38m Eliittiluokka Voittaja miesten seiväs Zep g. Zapati,, Z-vyöhyke: Z 25,69m Voittaja naisten kiekko Venla Sicinski,, Puola: 75,42m Voittaja naisten kiekko Cor g. Lomi,, Q-vyöhyke: 153,89m Voittaja miesten 1m Jerry Gloom, E-Afrikka: 9,58s Voittaja miesten 1m Ru g. Casqui,, W-vyöhyke: W 4,8127s BIO

9 Akatemiaprofessori Leena Peltonen-Palotie, Kansanterveyslaitos Bioteknologia ja eurooppalaiset vahvuudet yhteisön, yksilön ja tieteen näkökulma Bioteknologia, molekyylilää ääketiede ja eurooppalaiset vahvuudet Leena Palotie Wellcome Trust Sanger Institute, Cambridge,UK Institute of Molecular Medicine, Helsinki The Broad Institute, MIT, Boston, MA,USA Genomiprojektin jälkeen: Koko perimän kattavat menetelmät selvittää terveyden ja sairauden biologia Genomi=Koko perimä Yli 25 lajin perimän emäsjärjestys, perimän tiedosto on löydettävissä tietokannoista (http://www.ncbi.nlm.nih.gov/genome/guide) Näiden joukossa on ihmisen perimän emäsjärjestys

10 Henkilökohtainen geenitiedostomme Noin 19 geenisanaa, 3 miljardia merkkiä (emästä), vastaa kooltaan 8 raamattua Geenisanat samoja kaikilla ihmisillä, yli 3 miljoonaa yksilöllistä kirjainvaihtelua (.1%) Kaikissa kudoksissa ja soluissa sama geenitiedosto, mutta tiedoston osia luetaan vaihdellen elämän eri vaiheissa Tarja Halonen Koko Perimän läpiluenta 21 AACATGGCCGCGGGCTGGAAGTGCGCATGAGCAGCTGTCTATGGAGATACCTAGGCCGGGAGA GGGAGAACACAGTTGGAGAAAATCGGCAGCTGAGACGGCCTTGGCCGGTGAGTGTAGGACCGG GCAGAAGTCTGGAAACTGGGTGGACTGGCAAGGCAGGGCAGCTTTGATTTTGTTTCCGTTTTTC AAGTTAGAGAACACTGCTGGGGAGGAAGCCTTTGTTTTGGGGGAGGGGGCTGTGCTGGTTCTT TATCTCATACCCTGCTTTGTGGGCCAAACTCTCTCCCTTCCCCAGAGCGCGAGCGTCCCAGCCCTC CTGCGCTGTCCAGCTGCGCGCCGCAGCCGCCGGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAG GCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGGGGCGCGGGGCTAAGACTGCGGGGCTGCGGGG TCACGGCGCAGGCTCCCGGGCTCGCGCCTGGCGGGCGCTCAGCTCCGTAAGCGCCTTCTGGTTG GTGAGCCTGCAGGGAGACGCCTCATTCTAAGGCAAGGTCTAGGTGCCTGACTTCTTTCGGGAGT TGATTTTTTTTCCCTTTGTGTCCAGACTTAGCAAGGGCTCTTACTGGGCCCTTCTGGCCTGAGCGT GCACACCACACAGAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCGCAGCCGCC GGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGG GGCGGCGGGGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTCGCGAGGA CCGGGCAGAAGTCTGGAAAC

11 Henkilö 1. Henkilö 2. AACATGGACGCGGGCTGGAAGTGC AACATGGGCGCGGGCTGGAAGTGC Henkilö 1. Henkilö 2. AACATGGATATATATATATGGAAGTGC AACATGGATATA TGGAAGTGC AACATGGCCGCGGGCTGGAAGTGCGCATGAGCAGCTGTCTATGGAGATACCTAGGCCGGGAGA GGGAGAACACAGTTGGAGAAAATCGGCAGCTGAGACGGCCTTGGCCGGTGAGTGTAGGACCGG GCAGAAGTCTGGAAACTGGGTGGACTGGCAAGGCAGGGCAGCTTTGATTTTGTTTCCGTTTTTC AAGTTAGAGAACACTGCTGGGGAGGAAGCCTTTGTTTTGGGGGAGGGGGCTGTGCTGGTTCTT TATCTCATACCCTGCTTTGTGGGCCAAACTCTCTCCCTTCCCCAGAGCGCGAGCGTCCCAGCCCTC CTGCGCTGTCCAGCTGCGCGCCGCAGCCGCCGGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAG GCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGGGGCGCGGGGCTAAGACTGCGGGGCTGCGGGG TCACGGCGCAGGCTCCCGGGCTCGCGCCTGGCGGGCGCTCAGCTCCGTAAGCGCCTTCTGGTTG GTGAGCCTGCAGGGAGACGCCTCATTCTAAGGCAAGGTCTAGGTGCCTGACTTCTTTCGGGAGT TGATTTTTTTTCCCTTTGTGTCCAGACTTAGCAAGGGCTCTTACTGGGCCCTTCTGGCCTGAGCGT GCACACCACACAGAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCGCAGCCGCC GGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGG GGCGGCGGGGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTCGCGAGGA CCGGGCAGAAGTCTGGAAACAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCG CAGCCGCCGGCACCGGGCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGA GCAGCTGGGGCGCGGGGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTC GCGCCTGGCGGGCGCTCAGCTCCGTAAGCGCCTTCTGGTTGGTGAGCCTGCAGGGAGACGCCTC ATTCTAAGGCAAGGTCTCCGTTTTTCAAGTTAGAGAACACTGCTGGGGAGGAAGCCTTTGTTTTG GGGGAGGGGGCTGTGCTGGTTCTTTATCTCATACCCTGCTTTGTGGGCCAAACTCTCTCCCTTCC CCAGAGCGCGAGCGTCCCAGCCCTCCTGCGCTGTCCAGCTGCGCGCCGCAGCCGCCGGCACCGG Ihmisten välinen geenitekstin ero.1% GCGCTTGAGCTCCCTAGTCCCCGAGGCCCTTTCCTGCCTCCTCCGCGGAGCAGCTGGGGCGCGG GGCTAAGACTGCGGGGCTGCGGGGTCACGGCGCAGGCTCCCGGGCTCGCGCCTGGCGGGCGCT Miesten ja naisten valinen ero 1.4% CATGTGTCCAGA Perimän kirjaston sisältö Biologisen olemuksemme rakennusohjeisto Ihmiskunnan historian kirja Ihmisen sairauksien perinnöllisen taustan tiedosto

12 Genomin laajuisten analyysien perusteella on mahdollista: Ymmärtää elimistön toimintaa kokonaisuutena, tarkastelemalla muutoksia koko perimässä, perimän luennassa ja geenien yhteistoiminnassa Ymmärtää solujen poikkeavia reaktioita ihmisen sairauksissa uudella tavalla Tautien Genetic genetiikka Traits Simplex Harvinainen or monogenic tauti Complex Monitekijäinen or multifactorial kansantauti Tautigeeni Disease Susceptibility gene Alttiusgeeni Susceptibility Susceptibility gene Alttiusgeeni gene Alttiusgeeni gene Modifying Muokkaava gene geeni Environment Ympäristö Life Elintavat Style etc. Phenotype Tauti Phenotype Tauti Perinnöllinen tauti Monitekijäinen inen tauti Harvinainen Oireet lapsuusiässä Yhden geenin tauti "Mutaatio" Yleinen Oireet aikuisiässä Useita geenejä "DNA vaihtelu"

13 Suomi - Ehkä tautigeeneiltään n maailman parhaiten tunnettu väestv estö Perustajaväestö Sattuma (Drift) Isolaatio Alueellinen väestön kasvu 3 harvinaisen taudin rikastuma Väestörekisterit vuodesta1634 Julkisen terveydenhuollon rekisterit Hyvät kliinikot Väestön myönteinen asenne geenitutkimukseen Suomalaisten alkuperä voidaan tunnistaa genomin analyyseissä Swedes: N.Pedersen

14 Yksittäiset perheet voidaan yhdistää suuriksi muinais-sukupuiksi, joilla yhteinen perustaja Suuri todennäköisyys että suvun potilaat jakavat samat tautigeenit Kansantaudit Geenien vuoropuhelu Ympäristö Proteiinien vuoropuhelu Elintavat Perimän laajuiset analyysit Perimän laajuisten hakujen kauneus: Ei tarvita aiempaa tietoa tai hypoteesia sairauksien taustasta

15 27: Yleisten tautien geeniprofiilit Age-related macular degeneration Alzheimer's disease Amyotrophic Lateral Sclerosis Asthma Atrial fibrillation Bipolar disorder, Breast cancer Coronary artery disease, Crohn's disease, Diabetes, type 1 Diabetes, type 2 Hypertension Celiac disease Colorectal cancer Diabetic nephropathy Gallstone disease Glaucoma Inflammatory bowel disease Ischemic stroke Multiple sclerosis Myocardial infarct Nicotine dependence Obesity Prostate cancer Rheumatoid arthritis, Restless legs syndrome Perimän profiilit piirtyvät esiin: kansantautien riskigeenien tunnistus PPARg IBD5 NOD2 CTLA4 KCNJ11 PTPN22 CD25 IRF5 PCSK9 CFH NOS1AP IFIH1 PCSK9 CFB/C2 LOC q24 IL23R TCF7L2 MEIS1 CDKN2B/ALBXCOR1 8q24 #2BTBD9 8q24 #3C3 8q24 #48q24 8q24 #5ORMDL3 8q24 #64q25 ATG16L1TCF2 5p13GCKR 1q21FTO IRGMC12orf3 NKX2-3ERBB3 IL12BKIAA35 3p21CD226 1q2416p13 PTPN2 PTPN2 TCF2SH2B3 CDKN2B/AFGFR2 IGF2BP2TNRC9 CDKAL1MAP3K1 HHEXLSP1 SLC3A88q24 LOXL1 IL7R TRAF1/C5 STAT4 ABCG8 GALNT2 PSRC1 NCAN TBL2 TRIB1 KCTD1 ANGLPT3 GRIN3A Vaatii massiiviset aineistot ja genominlaajuisten teknologioiden ja laskennallisten analyysien osaamisen keskittymän Sample Intake Genotyping Data Review Data Transfer Follow-up

16 Suuri 12 M Euron EU hanke 24 partneria Suomi koordinoi, 12 eurooppalaisen geeniprofiilit European network for genetic and genomic epidemiology Website: ICELAND ENGAGE EU NORWAY SWEDEN FINLAND ESTONIA PORTUGAL NORTH. IRELAND DENMARK IRELAND UNITED KINGDOM HOLLAND BELGIUM GERMANY SPAIN FRANCE LUXEM- BOURG POLAND LITHUANIA RUSSIA UKRAINE CZECH. REP. SLOVAK REP. MOLDAVIA SWITZERLANDAUSTRIAHUNGARY SLOVENIA ROMANIA CROATIA BOSNIA - HERCEGOVINA JUGOSLAVIA ITALY BULGARIA MACEDONIA ALBANIA GREECE LATVIA BELO RUSSIA RUSSIA KAZAKHSTAN GEORGIA AZERBAIJAN ARMENIA TURKEY HDL, geneettinen alttiusprofiili: 2 kohorttihenkilöä

17 Suuret aineistot antavat mahdollisuuden tunnistaa myös s sukupuolten välisiv lisiä eroja tautialttiuksissa LDL geeniprofiili naiset LDL, geeniprofiili, miehet

18 Mitä hyötyä kansantautien geenitiedosta? Tuottaa uutta tietoa tautien molekyylitason taustasta Jaottelee tautidiagnoosit uudella tavalla, paremmin selvittäen taustalla olevaa biologiaa Hoitovasteen arviointi ja hoidon valinta helpottuu (lääkevaste) Geeniprofiilit selvittävät tautien biologiaa Tulevaisuuden lääketieteen perusta Diagnostiikka Ympäristötekijät, elintavat Uusi diagnostinen luokittelu Molekyylitason tapahtumien ymmärtäminen Uudet hoidon ja ennaltaehkäisyn strategiat Public Health Genomics Ateroskleroosi

19 mg/dl mg/dl LDL cholesterol < >13 Genotype score HDL cholesterol < >13 Genotype Score Yksilön kantamien riski geenien määrä korreloi veren lipidipitoisuuksiin ja infarkti-riskiin per 1-person years Myocardial incidence rate < >13 Genotype Score Naiset Sydäninfarktin riskigeenit Miehet Yksittäiset potilaat tai perheet voidaan yhdistää suuriksi muinaissukupuiksi, joilla yhteinen perustaja Suuri todennäköisyys että suvun potilaat jakavat samat tautigeenit

20 Suomalaiset perheet, joilla poikkeavat veren lipidiarvot: genominlaajuinen Haku löytää kytkin geenin Nature Genetics, 24 Mikä merkitys väestv estötasolla? tasolla? FINRISK kohortit Suomessa Suomen veronmaksajat maksaneet tiedon keräämisen joka viides vuosi: tarkka terveyskartoitus, linkitys terveydenhuollon rekistereihin ja DNA näytteet kerätty FINRISK-92 FINRISK-97 Geenin riskialleeli lisää naisten riskiä sairastua sydän-ja verisuonitauteihin CVD, 2.2 x riski Kuolleisuus: 2.48 x riski Suoja-alleeli suojaa sairastumiselta CVD:.53 x riski Kuolleisuus:.62 x riski

21 Perinnöllisyys vai elintavat? DNA-analyysit Omiikka Uusi Kuolinsyyrekisteri Epidemiologinen tieto ja osaaminen Lääkerekisterit Tautirekisterit Hoitoilmoitusrekisteri Suomen ja Euroopan etulyöntiasema Luotettava terveydenhuolto Korkeatasoinen ja tasa-arvoinen terveydenhuolto Huipputason asiantuntevuus kliinisessä lääketieteessä, genetiikassa, matematiikassa ja epidemiologiassa Hyvä mahdollisuus tautien genomitason tutkimuksiin ja tulosten nopeaan soveltamiseen KANSALLISESSA terveydenhuollossa: hoidossa ja ennaltaehkäisyssä

22 1966 Random samples Kansalliset kohortit the National Biobanks (7 indiv) (12 indiv) (9 5 indiv) (29 indiv) Twins Oulu Birth Cohort -66 Oulu Birth Cohort -86 ATBC Families (6 5 indiv) (35 indiv) Finnrisk -92 Finnrisk -97,2 Health 2 Pohjois-Suomi-kohortti: 1966, 1986 M A C R O S O C I A L E N V T M I C R O S O C I A L E N V I R O N M E N T LIFE COURSE PERSPECTIVE S U B C L I N I C A L C L I N I C A L H E A L T H O U T C O M E S

23 Suuria biopankkeja Estonian Genome project DeCode (Iceland) Carthagen (Canada) UK Biobank Japan Biobank Swedish National Biobank Program (Swegene, Wallenberg Consortium North) Genomeutwin cohorts NIH Prospective cohort based population study Tutkimuskokoelmat vs. diagnostiset näytteet Tutkimustarkoituksiin kerättyjä näytteitä ja niiden tuloksia ei voida käyttää diagnostisessa mielessä! tutkimuslaboratoriot eivät ole diagnostisia laboratorioita tutkittavat eivät ole sitoutuneet ja valmistautuneet siihen, että heidän tietojaan käytetään heidän hoitoonsa, ehkä vasta vuosien päästä saatavien tulosten selkiinnyttyä Suuret geneettisepidemiologiset hankkeet ovat massiivista tilastollista tietojen käsittelyä. Niissä kerättävät geenianalyysien tulokset eivät tarjoa diagnostista informaatiota yksilötasolla

24 DNA-analyysit Omiikka Uusi yhteys Kuolinsyyrekisteri Epidemiologinen tieto ja osaaminen Lääkerekisterit Tautirekisterit Hoitoilmoitusrekisteri Mitä hyötyä kansantautien geenitiedosta? Tuottaa uutta tietoa tautien molekyylitason taustasta Jaottelee tautidiagnoosit uudella tavalla, paremmin selvittäen taustalla olevaa biologiaa Hoitovasteen arviointi ja hoidon valinta helpottuu (lääkevaste) Yksilölliseen riskiarvioon toistaiseksi vain niukka merkitys

25 FIMM International framework Science Health Technology Public-private partnership Molekyylilääketieteen Instituutti (FIMM) Tieteelliset löydökset Tietoa kansanterveyden parantamiseen Uudet teknologiat Teolliset yhteistyöt Vahva kansainvälinen profiili, yhteistyö poikki kolmen ministeriön, teollisuus-yhteydet, hyvät genomitekniikat kansallisina palveluyksikköinä Meilahti campus area FIMM 51

26 Tutkija Martti, Etla Biotekniikkayritysten menestystekijät Biotekniikkayritysten menestystekijät Martti Elinkeinoelämän Tutkimuslaitos ETLA Globaaleja megatrendejä 1. Demografia? Eurooppa: eläke-järjestelmät ja terveydenhuollon kustannukset 2. Fossiilisten polttoaineiden käyttö? saastuminen ja ilmastonmuutos 3. Fossiilisten polttoainevarantojen väheneminen ja keskittyminen? uhka nykyiselle taloudelliselle ja poliittiselle tasapainolle 4. Globalisaatio edennyt kolmanteen vaiheeseensa? T&K toimintoja siirretään kehittyviin talouksiin 5. Teknologinen orientaatio ja digitalisaatio laajenevat kattamaan kaikki elämän osa-alueet Bioteknologia teollisena toimialana Menestystä ei voi suunnitella Potentiaalinen lähde alueelliselle ja kansalliselle talouskehitykselle vahva tuki itsessään muokkaa sektoria Bioteollisuus jäänyt suhteellisen pieneksi

27 United States (1) EU (4) Germany (2,3) United Kingdom (1) Korea (24) (3) Canada (2,3) France (1) Switzerland (24) (1) Belgium (2,3) Israel (22) (3) Sweden (1) Ireland Finland (1) Austria (1) Italy (1) South Africa (22) (2,3) Norway (1) Iceland (3) Poland (24) (2,3) New Zealand (25) (3) Bioteknologian työllisyysvaikutus OECD-maissa (Van Beuzekom ja Arundel 26) Portugal (1) Persons Paikalliset arvoverkot Kansalliset klusterit vientikilpailussa Kuva: Rouvinen -Ylä-Anttila Globalisaatio hajottaa klusterit! Maat/alueet erikoistuvat toiminnoittain, eivät aloittain Kuva: Rouvinen -Ylä-Anttila

28 USAn biotekniikkaklusterit Lähde: The Brookings Insitute Suomen biotekniikkaklusterit Kotimaiset yhteistyöverkostot ja alueellinen erikoistuminen Specialization Drug index development Diagnostics Biomaterials Bioinformatics Enzymes Food and Feed Agroforest Environment R%D services Helsinki Turku Tampere 5 2 Kuopio Oulu 2 4 5

29 Erikoistumisindeksi Specialization Index Specialization index Drug development Diagnostics Biomaterials Bioinformatics Enzymes Food and feed Agroforest Environment R&D services Helsinki Turku Tampere 5 2 Kuopio Oulu Suomen innovaatiotoiminnan haasteet: Suomi innovaatiotoiminnan eturintamassa kiinnikuromisen sijasta rintamaa työnnettävä eteenpäin Radikaalit läpimurtoinnovaatiot Perustutkimus Suomi edelleen alisuorittaja tutkimustulosten kaupallistamisessa voiko/pitäisikö teknologian siirtoa edistää? Menestystä ei voi suunnitella kokeellisuus, yllätyksellisyys Tutkimusjärjestelmä edelleen heikohkosti kansainvälistynyt miten hyödyntää paremmin globaalisti tuotettua tietoa? Määritelmän mukaan vain (globaalisti) paras tutkimus voi työntää eturintamaa Pienen maan pulma: paras voi olla vain harvoilla aloilla strategisten valintojen vaikeus Pekka Ylä-Anttila: Tieteellinen tutkimus ja tutkimusrahoitus innovaatiojärjestelmässä työpaja Suomen Akatemia Suomen asemointi Bioteknologian sovellusalueet Valkoinen Punainen Vihreä Bioinformatiikka Tukiteollisuus Teollisuuden oma näkemys:

30 Lyhyen aikavälin vahvuudet ja heikkoudet Tieteellinen osaaminen Tekes Vahvuus Heikkous Julkisen sektorin tuki Liiketoimintaosaaminen Verkostoituminen Terveydenhuoltojärjestelmä Rahoitusjärjestelmä Sitra -8. % -6. % -4. % -2. %. % 2. % 4. % Pitkän aikavälin mahdollisuudet ja uhat Yleiset tulevaisudennäkymät Rahoitusjärjestelmän kehittyminen Kyky löytää fokus Verkostoituminen, hyötyjen leviäminen Toimialan luonne Julkisen sektorin tuki Koulutus, Tieteellinen osaaminen Ammatimainen johtajuus Julkinen asenne Pieni mittakaava Sitra Mahdollisuus Uhka -3. % -2. % -1. %. % 1. % 2. % 3. % Sweden Switzerland Germany Finland United Kingdom Austria France United States Australia Netherlands Norway Denmark Belgium Portugal(2) Ireland Spain New Zealand Canada(2) Korea Czech Republic Slovak Republic Japan Hungary Italy Turkey Tohtoriopiskelijoiden määrä suhteessa ikäluokkaan ja ulkomaalaisten opisk. osuus Tohtoriopisk. lkmsuhteessa ikäluokkaan,% 1,% 2,% 3,% Switzerland United Kingdom Belgium United States Australia Sweden Denmark (1999) Canada (2) Norway Austria Iceland Spain New Zealand Czech Republic Portugal (2) Finland Turkey(1999) SlovakRepublic Korea Mexico Italy Japan Hungary Italy Turkey Ulkom. tohtoriopiskelijoiden osuus % 2% 4%

31 Globaaleja megatrendejä 1. Demografia? Eurooppa: eläke-järjestelmät ja terveydenhuollon kustannukset 2. Fossiilisten polttoaineiden käyttö? saastuminen ja ilmastonmuutos 3. Fossiilisten polttoainevarantojen väheneminen ja keskittyminen? uhka nykyiselle taloudelliselle ja poliittiselle tasapainolle 4. Globalisaatio edennyt kolmanteen vaiheeseensa? T&K toimintoja siirretään kehittyviin talouksiin 5. Teknologinen orientaatio ja digitalisaatio laajenevat kattamaan kaikki elämän osa-alueet Forestry (4) Devices (9) Other (29) Biomaterials (2) Consultancy Services (9) Food and Feed (45) Diagnostics (46) Agriculture (7) Diagnostic services (27) R&D services (18) Drug development (56) Enzymes (12) Bioinformatics (4) Environment (1) Bioteknologia: tulevaisuuden ala Bioteknologian kehitysajat Average Median Biotekniikka I, Years Hermans & Teollisuustuotanto sektoreittain, vuoden 2 hinnoissa

32 Suomi on siirtynyt lähelle eturintamaa Haasteet: Kiinnikuromisen sijasta pitäisi rintamaa siis työntää eteenpäin Radikaaleilla, läpimurtoinnovaatioilla entistä suurempi merkitys Perustutkimuksen rooli kasvaa Suomi on edelleen (lievä) alisuorittaja tutkimustulosten kaupallistamisessa voiko/pitäisikö teknologian siirtoa edistää? Menestystä ei voi suunnitella kokeellisuus, yllätyksellisyys Tutkimusjärjestelmä on edelleen suhteellisen heikosti kansainvälistynyt miten hyödyntää paremmin globaalisti tuotettua tietoa? määritelmän mukaan vain (globaalisti) paras tutkimus voi työntää eturintamaa Pienen maan pulma: paras voi olla vain harvoilla aloilla strategisten valintojen vaikeus Yhteenveto - johtopäätöksiä Eturintamassa pysymisen ehto on tutkimuksen kansainvälisyys suuretkin maat (USA) hankkivat yhä suuremman osan tiedosta muualta Samanaikaisesti tehtävä valintoja kärkitutkimuksen aloista ja edistettävä tutkimustulosten ja teknologioiden käyttöönottoa: alueellinen erikoistuminen Tiedon ja teknologian siirto yliopistoista: TTO? Bioteknologia perinteisen teollisuuden uudistajana Jo kaupallistamisvaiheessa olevat hankkeet yhteistyössä globaalien jättien kanssa Lisäoptio: Julkinen sektori kestävän kehityksen mahdollistajana Bioteknologia, kestävää kehitystä? Kvartaalitalous vs. kestävä kehitys Pitkät kehitysajat

33 Kestävä kehitys Onko Suomella hyvinvointiyhteiskuntana tuoda kehitykseen lisäarvoa? Osaamispohja hyvä: Tohtoriopiskelijoiden määrä suhteessa ikäluokkaan. Ulkomaisten opiskelijoiden osuus kansianväliset kontaktit! Globaali ajattelutapa! Huom: ei vain markkinat, vaan myös globaalit kilpailijat omalla takapihalla. opettajia Suomeen opiskelijoita ulkomaille Huom! Suomen osuus globaaleista tutkimusmenoista Huom! Globalisoituminen Suomen etu Bioteknologian pk-yritykset ja niiden henkilöstö Yhtiöiden Henkilöstö Alue lukumäärä yhteensä keskimäärin Helsinki Turku Tampere Kuopio Oulu Muut Yhteensä

34 Strateginen viitekehys Teknologinen merkitt ävyys Ainutlaatuiset Unique tuotannontekijät factors of japroduction -rakenteet Alueellinen erikoistuminen 2. Kysyntäohjautuva kaupallistamisstrategia Poikkitieteellisten osaamisperustojen hyödyntäminen 3. Kansainvälisesti kilpailukykyiset teolliset tukialat Taloudellinen arvo 4. Vaativa Domestic market markkinalaboratorio laboratory Teollinen klusteroituminen Jakelukananvat ja partnerit Globaalit markkinat National targets for R&D spending Lähde: OECD Science, Technology and Industry Outlook 26 Globalisaatio ja bioteknologia Halpatuotantoilmiön sijaan syntynyt runsaasti pieniä kilpailevia teknologiakeskuksia ympäri maailman

35 Alueet/maat erikoistuvat toiminnoittain Maa 1 Maa N Yritys 1 Yritys N Kuva: Rouvinen -Ylä-Anttila Porterin timanttimalli Climate for for Innovation- Based Local Rivalry Factor (Input) Conditions Demand Conditions Clusters of of Related and Supporting Industries Bioteknisen P&kteollisuuden kansainväliset yhteistyöverkot

36 Lehtori Mervi Skyttä, Matinkylän koulu, Espoo Elämän suojelu yleistavoitteena: Ympäristönsuojelusta elämänsuojeluun Bioyhteiskunta edellyttää paradigman muutoksen Johdannoksi: Mitä elämä on? Elämä on maapallon pintaosien kaikki kolkat kattava prosessi, geneettiseen informaatioon perustuva kerrostunut rakennelma, jossa edellinen taso ennustaa seuraavan mahdollisuudet. Elämä on eliöissä, ja niistä muodostuva biodiversiteetti on kaiken elämäkeskustelun perusta. Informaatio puolestaan on punoutunut makromolekyyliin, orgaaniseen aineeseen, jonka nimi on DNA. Puhumme tuttavallisesti geeneistä. Ihmisen DNA on samaa kuin muillakin eliöillä, olivatpa ne eläimiä, sieniä, kasveja tai mikrobeja. Ei ole pääsääntöisesti erikseen ihmisen geenejä. Esimerkkinä mainittakoon Suomessa parhaillaan tehtävä tutkimus, jossa taltioidaan lemmikkikoirien DNA:ta ihmisen tautigeenien tunnistamiseksi. Elämä on ilmiö, jossa geneettinen informaatio pyörittää energian turvin valtaisaa ainemäärää. Elämän monimuotoisuuden synty puolestaan on seurausta luonnon äärimmäisestä energia- ja materiaalitehokkuudesta. Energia virtaa ja aine kiertää kaikessa luonnollisessa tuotannossa, kulutuksessa ja hajotuksessa. Tässä Elämän kaavassa ihminen on luonnostaan kuluttaja. Eliökunnan satoja miljoonia vuosia kestäneen historian kuluessa informaatio, RNA:na ja DNA:na, on muovautunut kaikiksi niiksi lukemattomiksi elämänmuodoiksi, jotka maapallolla joskus ovat eläneet, kuten myös miljooniksi eliölajeiksi, jotka nykyään elävät maapallolla. Mikäli avaruusolennot jotenkin päätyisivät maapalloa tutkimaan, he kyllä toteaisivat, että täällä vallitsee elämä. Biodiversiteetistä pääteltäisiin elämän kehittyneisyyden aste ja sen laadun mukaan arvioitaisiin elämän vakautta ja tulevaisuutta. Mikä olisi ihmisen sija? Varmaankin hankala sivuosa, sillä elämän omat mahdollisuudet ovat lopulta sen moninaisuuden varassa. Tieteellinen tieto elämästä moninkertaistuu lyhyessä ajassa. Tiedon sisältö sen merkityksestä puhumattakaan ei ennätä riittävästi karttua kansalaisten osaamispääomaksi. Ennakkoluulot ovat joskus hyödyllisiä, mutta kohtuuton epäily tiedon sovellusten suhteen kielii, että biologian osalta sivistystä ei ole saavutettu. Elämän kokonaisuuden oivaltaminen vaatii enemmän aikaa, kuin mitä sen opiskeluun kansalaisten koulujärjestelmässä on suotu. Mediakriittisyydestä ei voida uneksiakaan, ellei ihmisten päässä ole riittävää asiasisältöä, faktaa. Kansalaistiedon puute johtaa pahimmillaan meritokratiaan, joka ei istu demokraattiseen järjestelmään. Tämä ihmisen ympäristö vuoden 27 lehtikuvan kertomana Vuoden 27 lehtikuvaan Helsingin Sanomien valokuvaaja Hannes Heikura naulitsi kaksi liikettä, veneen ja veden. On jo signaali sinänsä, että tällainen aihe vene kyntämässä Itämeren sinileväpuuroa oli voittoisa. Lukuisista hankkeista huolimatta Itämeren kunto pysyy huonona vielä pitkään. Meren tila kielii suuren populaation elintasosta ja kulttuurisista tavoista; kansojen ruokailusta, hygieniasta ja tuotantotaloudesta. Katsotaan asiaa suomalaisittain, keskitytään ruokaan. Sen hinta on pyhä käsite, ruoka ei saa maksaa! Jotta ruuan tuottaja hankkisi elantonsa siinä missä muutkin palkansaajat, hänen on koko ajan pystyttävä myymään samalta alalta suurempi sato. Osa tuotannon kiihdytysmateriaalista valuu tuotantosyklin ohi kuormittamaan vesistöjä. Pitää kuitenkin muistaa, että ravinteiden valtavirta kulkeutuu pellolta rehuksi ja usean portaan kautta ruokapöytiin. Edelleen ei sovi unohtaa, että ketju ei pysähdy vielä pöytäänkään. Leväkukinnot suorastaan huutavat, että virtsan, sonnan ja muunkin likaliemen valunta Itämereen on saanut jatkua turhan pitkään. Tuskin kukaan on tietämätön sen suhteen, että ravinnevuoto mereen on vastenmielisen ilmiön perimmäinen syy. Asiain tila onneksi on muuttumassa, joskaan sataprosenttista puhdistusta ei pitkään aikaan saavuteta. Mutta miten muuttuisi rantojen asukkaiden asenne suhteessa yhdessä luotuun elintasoon? Eikö jokaisen

Suomen biokapasiteetti ja sen. Prof. Jyri Seppälä Suomen ympäristökeskus

Suomen biokapasiteetti ja sen. Prof. Jyri Seppälä Suomen ympäristökeskus Suomen biokapasiteetti ja sen kestävä ä käyttö Prof. Jyri Seppälä Suomen ympäristökeskus Suomen kestävän kehityksen toimikunta 4 / 2010 Suomen ekologisen jalanjäljen ja biokapasiteetin kehitys Lähde: Global

Lisätiedot

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä?

Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Miten väestötutkimuksista ja biopankeista saadaan tietoa yksilöllisestä sairausriskistä? Markus Perola, LT, dosentti THL, KATO, Kansantautien geenien tutkimusyksikkö, kvantitatiivisen genetiikan ryhmä

Lisätiedot

SOSIAALITURVA JA LUOTTAMUS. Heikki Ervasti Seminaarialustus Työeläkepäivä

SOSIAALITURVA JA LUOTTAMUS. Heikki Ervasti Seminaarialustus Työeläkepäivä SOSIAALITURVA JA LUOTTAMUS Heikki Ervasti Seminaarialustus Työeläkepäivä 20.10.2010 2 Mitä on luottamus? Sosiaalinen pääoma = yhdistystoiminta + luottamus Luottamus instituutioita kohtaan Luottamus toisia

Lisätiedot

Kuinka ammattirakenteet mukautuvat globaaleihin arvoketjuihin

Kuinka ammattirakenteet mukautuvat globaaleihin arvoketjuihin Kuinka ammattirakenteet mukautuvat globaaleihin arvoketjuihin Mika Maliranta (ETLA & Jyväskylän yliopisto) Maakunnan yhteistyöryhmän tulevaisuusfoorumi, osa 2, Jyväskylä, 10.5.2011 THE RESEARCH INSTITUTE

Lisätiedot

Metsien luonnontuotteet ja luomu. Rainer Peltola, MTT Rovaniemi / LAPPI LUO

Metsien luonnontuotteet ja luomu. Rainer Peltola, MTT Rovaniemi / LAPPI LUO Metsien luonnontuotteet ja luomu Rainer Peltola, MTT Rovaniemi / LAPPI LUO Keruuluomu / luomukeruu Luonnonmarjat ja -sienet ovat luomua, jos ne on kerätty erikseen määritellyiltä luomukeruualueilta Keruualueeksi

Lisätiedot

Väestöennuste 2012 mikä muuttui?

Väestöennuste 2012 mikä muuttui? mikä muuttui? Markus Rapo, Tilastokeskus Rakenteet murroksessa pohjoinen näkökulma 29.11.2012, Oulu Esityksessäni Havaittu väestökehitys Tilastokeskuksen väestöennuste luonne ja tulkinta oletukset (vs.

Lisätiedot

Projektikokemuksia pk-yrityshankkeista

Projektikokemuksia pk-yrityshankkeista Projektikokemuksia pk-yrityshankkeista Jari Uotila VTT Research for SMEs ohjelman hakemuskoulutus 05.09.2012 2 Miksi PK-yritys mukaan EU-hankkeisiin Vähäriskinen tapa aloittaa kansainvälistyminen Uusien

Lisätiedot

MEKIN UUDET HAASTEET. Keski-Suomen matkailuparlamentti Jyväskylä 29.11.2006. Pirkko Perheentupa Matkailun edistämiskeskus

MEKIN UUDET HAASTEET. Keski-Suomen matkailuparlamentti Jyväskylä 29.11.2006. Pirkko Perheentupa Matkailun edistämiskeskus MEKIN UUDET HAASTEET Keski-Suomen matkailuparlamentti Jyväskylä 29.11.2006 Pirkko Perheentupa Matkailun edistämiskeskus MEKin uudet tehtävät 2007 Yhtenäistää ja selkeyttää Suomen matkailullista kokonaiskuvaa

Lisätiedot

Tuottavuuskehitys pkyrityksissä

Tuottavuuskehitys pkyrityksissä Tuottavuuskehitys pkyrityksissä Mika Maliranta (ETLA & Jyväskylän yliopiston kauppakorkeakoulu) Talouskasvua pk-yritysten tuottavuutta kehittämällä, TEM, 20.10.2010 1 Johtopäätökset (1/2) Kasvupolitiikka

Lisätiedot

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1)

Biologia. Pakolliset kurssit. 1. Eliömaailma (BI1) Biologia Pakolliset kurssit 1. Eliömaailma (BI1) tuntee elämän tunnusmerkit ja perusedellytykset sekä tietää, miten elämän ilmiöitä tutkitaan ymmärtää, mitä luonnon monimuotoisuus biosysteemien eri tasoilla

Lisätiedot

Kilpailu tulevaisuuden Suomelle

Kilpailu tulevaisuuden Suomelle Kalle Nieminen Asiantuntija, Sitra 28.11.2016 Miksi juuri nyt? Megatrendit 2016 Osaamisen tunnistaminen tulevaisuudessa Ratkaisu 100 Kilpailu tulevaisuuden Suomelle 1 Miten haaste on valittu? 1. 2. 3.

Lisätiedot

Mäntyöljykyllästys vaihtoehto kreosootille?

Mäntyöljykyllästys vaihtoehto kreosootille? 28.5.2014 1 Mäntyöljykyllästys vaihtoehto kreosootille? Lieksan Puuakatemia seminaari Puun käytön laaja-alaistaminen Janne Monni, vtj, Iivari Mononen Oy 20.-21.5.2014 Lieksa 28.5.2014 2 Esityksen sisältö

Lisätiedot

Mitä on GLP? Pirkko Puranen, ylitarkastaja, FT Fimea, Luvat ja tarkastukset

Mitä on GLP? Pirkko Puranen, ylitarkastaja, FT Fimea, Luvat ja tarkastukset Mitä on GLP? Pirkko Puranen, ylitarkastaja, FT Fimea, Luvat ja tarkastukset Miksi GLP (Good Laboratory Practice)? Kemikaalien ja lääkkeiden turvallisuuden testaamiseksi myyntilupaa tai rekisteröintiä varten

Lisätiedot

Porvoon matkailun tunnuslukuja huhtikuu 2012

Porvoon matkailun tunnuslukuja huhtikuu 2012 Porvoon matkailun tunnuslukuja huhtikuu 2012 Yöpymiset + 12,5 % tammi-huhtikuussa Porvoon majoitusliikkeiden rekisteröidyt yöpymiset (33.900) lisääntyivät tammi-huhtikuussa 12,5 % edellisvuodesta. Kasvua

Lisätiedot

Korkeakoulutettujen työllistyminen ja työmarkkinoiden muutokset

Korkeakoulutettujen työllistyminen ja työmarkkinoiden muutokset Korkeakoulutettujen työllistyminen ja työmarkkinoiden muutokset Osaamista ohjaukseen koulutuspäivä 13.3.2015, Lahti Heikki Taulu ekonomisti Akava 25 20 15 10 5 0 Työttömyysaste Suomessa, Euroopassa ja

Lisätiedot

ÍOppiaineen nimi: BIOLOGIA 7-9. Vuosiluokat. Opetuksen tavoite Sisältöalueet Laaja-alainen osaaminen. Arvioinnin kohteet oppiaineessa

ÍOppiaineen nimi: BIOLOGIA 7-9. Vuosiluokat. Opetuksen tavoite Sisältöalueet Laaja-alainen osaaminen. Arvioinnin kohteet oppiaineessa ÍOppiaineen nimi: BIOLOGIA 7-9 Vuosiluokat Opetuksen tavoite Sisältöalueet Laaja-alainen osaaminen Biologinen tieto ja ymmärrys 7 ohjata oppilasta ymmärtämään ekosysteemin perusrakennetta ja tunnistamaan

Lisätiedot

Tulevaisuuden osaaminen. Ennakointikyselyn alustavia tuloksia

Tulevaisuuden osaaminen. Ennakointikyselyn alustavia tuloksia Tulevaisuuden osaaminen Ennakointikyselyn alustavia tuloksia 19.3.2010 Teemat Tulevaisuuden taidot ja osaaminen Tulevaisuuden osaamisen vahvistaminen koulutusjärjestelmässä Tieto- ja viestintätekniikan

Lisätiedot

Suomen mahdollisuudet innovaatiovetoisessa kasvussa

Suomen mahdollisuudet innovaatiovetoisessa kasvussa Suomen mahdollisuudet innovaatiovetoisessa kasvussa 1. Mitkä ovat kasvun tyylilajit yleensä? 2. Globalisaatio haastaa rikkaat maat; olemme siis hyvässä seurassa 3. Kasvu tulee tuottavuudesta; mistä tuottavuus

Lisätiedot

Erasmus-liikkuvuus Suomesta

Erasmus-liikkuvuus Suomesta Erasmus-liikkuvuus Suomesta 2007-2011 Erasmus-opiskelijaliikkuvuus Suomesta maittain Country 2007/08 2008/09 2009/10 2010/11 AT - Austria 239 242 230 264 BE - Belgium 88 102 109 124 BG - Bulgaria 8 15

Lisätiedot

Ajankohtaista Fingridistä

Ajankohtaista Fingridistä 1 Ajankohtaista Fingridistä Jukka Ruusunen Toimitusjohtaja, Fingrid Oyj Verkkopäivä 9.9.2008 2 Mielenkiintoinen toimintaympäristö! Suomen ilmasto- ja ja energiastrategia Suuret ydinvoimayksiköt Tuulivoima

Lisätiedot

Porvoon matkailun tunnuslukuja Marraskuu 2012

Porvoon matkailun tunnuslukuja Marraskuu 2012 Porvoon matkailun tunnuslukuja Marraskuu 2012 Yöpymiset + 0,4 % tammi-marraskuussa Porvoon majoitusliikkeiden rekisteröidyt yöpymiset (116.500) lisääntyivät tammi-marraskuussa 0,4 % edellisvuodesta. Kasvua

Lisätiedot

Tutkimustoiminnan kansainvälinen tilastointi. KOTA seminaari Ari Leppälahti

Tutkimustoiminnan kansainvälinen tilastointi. KOTA seminaari Ari Leppälahti Tutkimustoiminnan kansainvälinen tilastointi KOTA seminaari 12.9.2012 Ari Leppälahti Esityksen sisältö Taustaa ja yleistä tutkimus- ja kehittämistoiminnan (t&k) tilastoinnista Menetelmistä Esimerkkejä

Lisätiedot

Fingrid uuden edessä. Toimitusjohtaja Jukka Ruusunen. Kantaverkkopäivä

Fingrid uuden edessä. Toimitusjohtaja Jukka Ruusunen. Kantaverkkopäivä Fingrid uuden edessä Toimitusjohtaja Jukka Ruusunen Kantaverkkopäivä 7.9.2011 Perimmäisten kysymysten äärellä Kuka saa omistaa ja ohjata kantaverkkoyhtiöitä? Kantaverkkotoiminnan eriytys Fingridillä uusi

Lisätiedot

Case Arla: Luomu meillä ja maailmalla. Nnenna Liljeroos 1.10.2014

Case Arla: Luomu meillä ja maailmalla. Nnenna Liljeroos 1.10.2014 Case Arla: Luomu meillä ja maailmalla Nnenna Liljeroos 1.10.2014 Arla on kansainvälinen ja paikallinen meijerialan suunnannäyttäjä. Kannustamme ihmisiä ympäri maailman elämään terveellisesti tarjoamalla

Lisätiedot

ZA4880. Flash Eurobarometer 239 (Young people and science) Country Specific Questionnaire Finland

ZA4880. Flash Eurobarometer 239 (Young people and science) Country Specific Questionnaire Finland ZA4880 Flash Eurobarometer 239 (Young people and science) Country Specific Questionnaire Finland FLASH 239 YOUNG PEOPLE AND SCIENCE D1. Sukupuoli [ÄLÄ KYSY - MERKITSE SOPIVIN] Mies...1 Nainen...2 D2. Minkä

Lisätiedot

Maailmantalouden tulevaisuusnäkymät ja Suomen asema maailmassa: markat takas vai miten tästä selvitään? Nuoran seminaari 29.3. 2012 Mikko Kosonen

Maailmantalouden tulevaisuusnäkymät ja Suomen asema maailmassa: markat takas vai miten tästä selvitään? Nuoran seminaari 29.3. 2012 Mikko Kosonen Maailmantalouden tulevaisuusnäkymät ja Suomen asema maailmassa: markat takas vai miten tästä selvitään? Nuoran seminaari 29.3. 2012 Mikko Kosonen Sitran trendilista 1. Ennakoimattomien tapahtumien tiheys

Lisätiedot

Maailman osaavin kansa kirjan esittely

Maailman osaavin kansa kirjan esittely Maailman osaavin kansa 2020 -kirjan esittely Koulutustutkimusfoorumin kokous 26.9.2013 Kari Nyyssölä Opetusneuvos Opetushallitus Jyrki Kataisen hallituksen tavoite Hallitus asetti tavoitteeksi nostaa suomalaiset

Lisätiedot

Kohti uutta normaalia? Pakolaisuus ja muuttoliike lukuina, tänään

Kohti uutta normaalia? Pakolaisuus ja muuttoliike lukuina, tänään Kohti uutta normaalia? Pakolaisuus ja muuttoliike lukuina, tänään Pakolaisuus, muuttoliike ja eurooppalaiset ratkaisut - muuttajat ja muutoksen haasteet 4.12.2015 Rafael Bärlund Euroopan muuttoliikeverkosto

Lisätiedot

Merkittävää eriarvoisuutta WHO-Koululaistutkimuksen tuloksia nuorten terveydestä ja hyvinvoinnista

Merkittävää eriarvoisuutta WHO-Koululaistutkimuksen tuloksia nuorten terveydestä ja hyvinvoinnista SOSIAALILÄÄKETIETEEN PÄIVÄT 28.11.2012 Nuoret ja huono-osaisuus Merkittävää eriarvoisuutta WHO-Koululaistutkimuksen tuloksia nuorten terveydestä ja hyvinvoinnista Kristiina Ojala Jyväskylän yliopisto WHO-Koululaistutkimus

Lisätiedot

NUORET JA LIIKENNE. Aluepäällikkö Rainer Kinisjärvi Rovaniemi

NUORET JA LIIKENNE. Aluepäällikkö Rainer Kinisjärvi Rovaniemi NUORET JA LIIKENNE Aluepäällikkö Rainer Kinisjärvi 14.2.2013 Rovaniemi 2 Rainer Kinisjärvi Liikenneonnettomuudet ja uhrit 2012 254 kuollutta Yhteensä 26 000 loukkaantunutta (vuonna 2011). Poliisin tietoon

Lisätiedot

Kierretapit kunnossapitoon, korjauksiin ja huoltoon. Uudet tuotteet

Kierretapit kunnossapitoon, korjauksiin ja huoltoon. Uudet tuotteet Kierretapit kunnossapitoon, korjauksiin ja huoltoon Uudet tuotteet 2016.2 KIERRETAPIT KUNNOSSAPITOON, KORJAUKSIIN JA HUOLTOON JOHDANTO Dormer on täydentänyt laajaa kierretappivalikoimaansa kehittämällä

Lisätiedot

Suomi - Älykkään energiamittauksen kärkimaa

Suomi - Älykkään energiamittauksen kärkimaa Suomi - Älykkään energiamittauksen kärkimaa Jyväskylä 19.6.2012 Keski-Suomen Energiatoimisto Jyväskylä Innovation Oy 1 European Smart Metering Landscape report 2012 Älykkään energiamittauksen tilanne EU27+Norja

Lisätiedot

Mielenterveys voimavarana

Mielenterveys voimavarana Mielenterveys voimavarana Mielenterveydestä on esitetty aikojen kuluessa useita erilaisia näkemyksiä. Moderni määritelmä mielenterveydestä on terveyslähtöinen eli salutogeeninen. Mielenterveys nähdään

Lisätiedot

KOTKAN-HAMINAN SEUTU. MATKAILUN TUNNUSLUKUJA 13.6.2013 Huhtikuu. Kotka venäläisyöpymisissä Jonsuun ja Jyväskylän. Alkuvuoden yöpymiset + 11 %

KOTKAN-HAMINAN SEUTU. MATKAILUN TUNNUSLUKUJA 13.6.2013 Huhtikuu. Kotka venäläisyöpymisissä Jonsuun ja Jyväskylän. Alkuvuoden yöpymiset + 11 % KOTKAN-HAMINAN SEUTU MATKAILUN TUNNUSLUKUJA 13.6.2013 Huhtikuu Alkuvuoden yöpymiset + 11 % Kotkan-Haminan seudun majoitusliikkeiden rekisteröidyt yöpymiset (40.800) lisääntyivät tammi-huhtikuussa 11,4

Lisätiedot

VIHREÄ IDEOLOGIA SOLIDARITEETTIA KÄYTÄNNÖSSÄ Lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta

VIHREÄ IDEOLOGIA SOLIDARITEETTIA KÄYTÄNNÖSSÄ Lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta VIHREÄ IDEOLOGIA SOLIDARITEETTIA KÄYTÄNNÖSSÄ Lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta Tämä teksti on lyhyt tiivistelmä Ympäristöpuolue Vihreiden puolueohjelmasta. Kun puolueohjelma

Lisätiedot

CHEM-A jakson palautetilaisuus. Tapani Vuorinen

CHEM-A jakson palautetilaisuus. Tapani Vuorinen CHEM-A1000 1. jakson palautetilaisuus Tapani Vuorinen Sisältö 10:15 Aloitus ja ohjelma, Tapani 10:20 YTHS:n esittely & SÄTKY-kysely, Anna-Reetta 10:40 Vaihtoon 3. lukuvuotena, Heidi ja Kaisa 11:00 Omat

Lisätiedot

Eurooppa, me ja koulutuksen tulevaisuus

Eurooppa, me ja koulutuksen tulevaisuus Eurooppa, me ja koulutuksen tulevaisuus Jyrki J.J. Kasvi eduskunta, tulevaisuusvaliokunta 24.11. 2009 www.kasvi.org 1 EU on vapaata liikkuvuutta Sisämarkkinoiden neljä vapautta: pääomien, tavaroiden, palveluiden

Lisätiedot

Tietoa ja tuloksia tutkittavalle: miten ja miksi?

Tietoa ja tuloksia tutkittavalle: miten ja miksi? Tietoa ja tuloksia tutkittavalle: miten ja miksi? Helena Kääriäinen tutkimusprofessori 29.1.16 HK 1 Potilaat ja kansalaiset ovat tutkimuksen tärkein voimavara Biopankkien pitäisi olla kansalaisen näkökulmasta

Lisätiedot

Markkinaraportti / heinäkuu 2010

Markkinaraportti / heinäkuu 2010 Markkinaraportti / heinäkuu 21 Yöpymismäärissä merkittävää kasvua heinäkuussa Yöpymiset Helsingin majoitusliikkeissä lisääntyivät heinäkuussa 18,2 % edellisvuoden heinäkuusta. Lisäystä tuli sekä kotimaasta

Lisätiedot

Alihankinta 2014 -messut Teema koneenrakentaminen. 18.9.2014 Petri Katajamäki ja Pekka Lappalainen

Alihankinta 2014 -messut Teema koneenrakentaminen. 18.9.2014 Petri Katajamäki ja Pekka Lappalainen Alihankinta 2014 -messut Teema koneenrakentaminen 18.9.2014 Petri Katajamäki ja Pekka Lappalainen DEMOGRAFIA Lähde: Statista 2013 Koko 357 092 km2 (1,05 x Suomi) 82,4 miljoonaa asukasta (15,8 x Suomi)

Lisätiedot

Perinnöllinen informaatio ja geneettinen koodi.

Perinnöllinen informaatio ja geneettinen koodi. Tehtävä A1 Kirjoita essee aiheesta: Perinnöllinen informaatio ja geneettinen koodi. Vastaa esseemuotoisesti, älä käytä ranskalaisia viivoja. Piirroksia voi käyttää. Vastauksessa luetaan ansioksi selkeä

Lisätiedot

Markkinaraportti / lokakuu 2010

Markkinaraportti / lokakuu 2010 Markkinaraportti / lokakuu 21 Yöpymiset lisääntyivät lokakuussa Sekä kotimaasta että ulkomailta saapuneiden yöpymisten määrä jatkoi kasvuaan Helsingissä myös lokakuussa. Erityisen voimakkaasti lisääntyivät

Lisätiedot

Markkinaraportti / tammikuu 2011

Markkinaraportti / tammikuu 2011 Markkinaraportti / tammikuu 211 Yöpymiset lisääntyivät tammikuussa 9 % Matkailu vilkastui Helsingissä yöpymisissä mitattuna tammikuussa 211 sekä koti- että vientimarkkinoilla. Nousua kirjattiin sekä vapaa-ajan

Lisätiedot

VANTAA Matkailun tunnuslukuja

VANTAA Matkailun tunnuslukuja VANTAA Matkailun tunnuslukuja Kesäkuu 212 www.vantaa.fi/yrityspalvelut Yöpymiset ulkomailta kesäkuussa + 8 % Vantaan majoitusliikkeiden rekisteröidyt yöpymiset (72.3) lisääntyivät kesäkuussa edellisvuodesta

Lisätiedot

BIOLOGIA 1. kurssi 7. luokka

BIOLOGIA 1. kurssi 7. luokka 1. kurssi 7. luokka Kurssin tavoitteena on ohjata oppilasta ymmärtämään elämän perusilmiöitä ja vesiekosysteemien rakennetta ja toimintaa. Tavoitteena on, että oppilas oppii tunnistamaan ja luokittelemaan

Lisätiedot

Kansaianvälinen aikuistutkimus PIAAC 2012

Kansaianvälinen aikuistutkimus PIAAC 2012 1 AIKUISKOULUTUS MARGINAALISTA KESKIÖÖN KVS140-Juhlavuoden seminaari Helsinki 21.3.2014 Kansaianvälinen aikuistutkimus PIAAC 2012 Antero Malin Koulutuksen tutkimuslaitos Jyväskylän yliopisto 2 Kansainvälinen

Lisätiedot

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2)

5.7 Biologia Perusopetus Opetuksen tavoitteet Valinnaiset kurssit 1. Elämä ja evoluutio (bi1) 2. Ekosysteemit ja ympäristönsuojelu (bi2) 5.7 Biologia Biologia tutkii elämää ja sen edellytyksiä. Opetus syventää aikuisopiskelijan luonnontuntemusta ja auttaa ymmärtämään luonnon perusilmiöitä. Biologian opiskelu kehittää opiskelijan luonnontieteellistä

Lisätiedot

Tuhkarokko- ja sikotautiepidemoita Euroopassa

Tuhkarokko- ja sikotautiepidemoita Euroopassa Tuhkarokko- ja sikotautiepidemoita Euroopassa Labqualityn neuvottelukokous 17.10.2008 Irja Davidkin Tuhkarokko ja sikotauti virusten aiheuttamia lastentauteja, jotka ennen rokotuksia esiintyivät epidemioina

Lisätiedot

Psyykkisten rakenteiden kehitys

Psyykkisten rakenteiden kehitys Psyykkisten rakenteiden kehitys Bio-psykososiaalinen näkemys: Ihmisen psyykkinen kasvu ja kehitys riippuu bioloogisista, psykoloogisista ja sosiaalisista tekijöistä Lapsen psyykkisen kehityksen kannalta

Lisätiedot

Työelämän muutos ja innovaatioyhteiskunnan osaamistarpeet

Työelämän muutos ja innovaatioyhteiskunnan osaamistarpeet Antti Kasvio Työterveyslaitos Työelämän muutos ja innovaatioyhteiskunnan osaamistarpeet Suomalainen koulutus 2030 foorumi 19.11. 2009 Jäsennystä Kaksi peruslähestymistapaa tulevaisuutta koskevassa keskustelussa

Lisätiedot

Rekrytoinnit, meritoituminen ja vaikuttavuus

Rekrytoinnit, meritoituminen ja vaikuttavuus Rekrytoinnit, meritoituminen ja vaikuttavuus Jukka Mönkkönen Rehtori Itä-Suomen yliopisto UEF // University of Eastern Finland Jukka Mönkkönen 20.12.2016 1 Tutkimuksen ja koulutuksen yhteiskunnalliset

Lisätiedot

KIRA-klusteri osaamis- ja innovaatiojärjestelmän haaste tai ongelma?

KIRA-klusteri osaamis- ja innovaatiojärjestelmän haaste tai ongelma? KIRA-klusteri osaamis- ja innovaatiojärjestelmän haaste tai ongelma? Tutkimus-, kehittämis-, ja innovaatiotoiminnan (TKI) ja osaamisen hallinto kiinteistö- ja rakennusalalla VTV:n työpaja, Helsinki, 11.4.2013

Lisätiedot

Urheilijan henkisen toimintakyvyn tukeminen

Urheilijan henkisen toimintakyvyn tukeminen Urheilijan henkisen toimintakyvyn tukeminen ELÄMÄN HALLINTA & HYVÄ ARKI ITSEVARMA URHEILIJA MYÖNTEINEN ASENNE MOTIVAATIO & TAVOITTEEN ASETTAMINEN Myönteinen asenne Pidä hyvää huolta sisäisestä lapsestasi,

Lisätiedot

BIOLOGIA -kurssien suoritusjärjestys on vapaa -oppiaineen hyväksytty suoritus edellyttää hyväksyttyä suoritusta kursseista 1 tai 2 ja 3 tai 4.

BIOLOGIA -kurssien suoritusjärjestys on vapaa -oppiaineen hyväksytty suoritus edellyttää hyväksyttyä suoritusta kursseista 1 tai 2 ja 3 tai 4. BIOLOGIA -kurssien suoritusjärjestys on vapaa -oppiaineen hyväksytty suoritus edellyttää hyväksyttyä suoritusta kursseista 1 tai 2 ja 3 tai 4. KURSSI 1 (1 vvt) käyttämään biologialle ominaisia käsitteitä

Lisätiedot

Työelämävalmiudet: Oivallus-hankeken seminaari

Työelämävalmiudet: Oivallus-hankeken seminaari Työelämävalmiudet: Oivallus-hankeken seminaari Optek Opetusteknologia koulun arjessa Jari Lavonen, Professor of Physics and Chemistry Education, Head of the department Department of Teacher Education,

Lisätiedot

Tulevaisuudentutkimus Pirkanmaalla

Tulevaisuudentutkimus Pirkanmaalla 1 Tulevaisuudentutkimus Pirkanmaalla Markus Pöllänen Lehtori, Tampereen teknillinen yliopisto Pirkanmaan ennakointiammattilaisten kokoontumisajot 28.5.2012 Tulevaisuudentutkimuksen lähtökohtana historian

Lisätiedot

Markkinaraportti / elokuu 2015

Markkinaraportti / elokuu 2015 Markkinaraportti / elokuu 2015 Yöpymiset yli 6 % nousussa Yöpymiset lisääntyivät Helsingissä elokuussa yli 6 % vuoden takaisesta. Yöpymismäärä, 407.100, oli kaikkien aikojen elokuun ennätys. Kotimaasta

Lisätiedot

Mitä muualla tehdään? Avoimen hallinnon virkamiesverkosto

Mitä muualla tehdään? Avoimen hallinnon virkamiesverkosto Mitä muualla tehdään? Avoimen hallinnon virkamiesverkosto 7.10.2014 OpenGovAwards- kilpailu www.opengovawards.org/results 1. Denmark Team 87.4 2. Montenegro Team 86.2 3. Philippines Team 85.8 4. Italy

Lisätiedot

SATAKUNNAN TULEVAISUUSFOORUMI 2014

SATAKUNNAN TULEVAISUUSFOORUMI 2014 SATAKUNNAN TULEVAISUUSFOORUMI 2014 PORI 17.12.201412 2014 Kaarina Nurmi Tutkimuspäällikkö, VTT Rauman kaupunki Elinkeino- ja suunnittelupalvelut kaarina.nurmi@rauma.fi 050 307 3542 RAUMAN ALUEEN KORKEAKOULUTUKSEN

Lisätiedot

HYVÄ ELÄMÄ KAIKILLE! UUSI AIKA ON TIE ETEENPÄIN

HYVÄ ELÄMÄ KAIKILLE! UUSI AIKA ON TIE ETEENPÄIN UUSI AIKA ON TIE ETEENPÄIN Nykyinen kapitalistinen taloudellinen ja poliittinen järjestelmämme ei ole enää kestävällä pohjalla Se on ajamassa meidät kohti taloudellista ja sosiaalista kaaosta sekä ekologista

Lisätiedot

Omahoidon juurruttamisen polut. Ennakointi ja sosiotekninen muutos Ikääntymisen tulevaisuudet Hotelli Arthur Sirkku Kivisaari

Omahoidon juurruttamisen polut. Ennakointi ja sosiotekninen muutos Ikääntymisen tulevaisuudet Hotelli Arthur Sirkku Kivisaari Omahoidon juurruttamisen polut Ennakointi ja sosiotekninen muutos Ikääntymisen tulevaisuudet Hotelli Arthur 10.10.12 Sirkku Kivisaari 2 Jäsennys 1. Mitä on terveys? 2. Paradigman muutos terveyspalveluissa

Lisätiedot

Lapsen oikeudet ulottuvat myös nettiin. Mari Laiho Nettiturvallisuustyön päällikkö

Lapsen oikeudet ulottuvat myös nettiin. Mari Laiho Nettiturvallisuustyön päällikkö Lapsen oikeudet ulottuvat myös nettiin Mari Laiho Nettiturvallisuustyön päällikkö Lapsen oikeudet YK:n lapsen oikeuksien yleissopimus valtioita sitova Lasten aseman, oikeuksien ja osallisuuden turvaaminen

Lisätiedot

SUOMEN AKATEMIAN YHTEISKUNTATIETEELLIS- PAINOTTEISTEN TUTKIMUSTEN RAHOITUSMUODOT Pauli Niemelä

SUOMEN AKATEMIAN YHTEISKUNTATIETEELLIS- PAINOTTEISTEN TUTKIMUSTEN RAHOITUSMUODOT Pauli Niemelä SUOMEN AKATEMIAN YHTEISKUNTATIETEELLIS- PAINOTTEISTEN TUTKIMUSTEN RAHOITUSMUODOT 15.6.2011 Pauli Niemelä TUTKIJAN URAN IDEA TOHTORIKOULUTUS (Tohtori-/tutkijakoulut), ei ilmeisesti laajene jatkossa, mutta

Lisätiedot

KESTÄVÄ KEHITYKSEN YHTEISKUNTASITOUMUS

KESTÄVÄ KEHITYKSEN YHTEISKUNTASITOUMUS KESTÄVÄ KEHITYKSEN YHTEISKUNTASITOUMUS Keskustelutilaisuus kestävän kehityksen edistämisestä korkeakouluissa 4.11.2013 Ilkka Turunen Neuvotteleva virkamies Kestävä kehitys valtioneuvoston strategioissa

Lisätiedot

Työttömyysetuuksien vaikutuksesta työmarkkinakäyttäytymiseen - tarkastelussa enimmäiskeston lyhennys

Työttömyysetuuksien vaikutuksesta työmarkkinakäyttäytymiseen - tarkastelussa enimmäiskeston lyhennys Työttömyysetuuksien vaikutuksesta työmarkkinakäyttäytymiseen - tarkastelussa enimmäiskeston lyhennys Merja Kauhanen Palkansaajien tutkimuslaitos Eduskunnan työelämä- ja tasa-arvovaliokunnan kokous 28.9.2016

Lisätiedot

9.12 Terveystieto. Espoon kaupungin opetussuunnitelmalinjaukset VUOSILUOKAT 7-9. 7. lk

9.12 Terveystieto. Espoon kaupungin opetussuunnitelmalinjaukset VUOSILUOKAT 7-9. 7. lk 9.12 Oppiaineen opetussuunnitelmaan on merkitty oppiaineen opiskelun yhteydessä toteutuva aihekokonaisuuksien ( = AK) käsittely seuraavin lyhentein: AK 1 = Ihmisenä kasvaminen AK 2 = Kulttuuri-identiteetti

Lisätiedot

Biopankki: ideasta käytäntöön

Biopankki: ideasta käytäntöön Biopankki: ideasta käytäntöön Kimmo Pitkänen Kehittämispäällikkö Suomen molekyylilääketieteen instituutti FIMM European Biotech Week, Biomedicum 2.10.2013 FIMM - Institute for Molecular Medicine Finland

Lisätiedot

Stenvest Oy - kultakolikkotaulukko

Stenvest Oy - kultakolikkotaulukko Maa Nimellisarvo Lyönti- Kolikon paino Kulta- Suomi 10 Markkaa 1878-1913 3,2258 0,9000 0,0933 2,903 (Finland) 20 Markkaa 1878-1913 6,4516 0,9000 0,1867 5,806 100 Markkaa 1926 4,2105 0,9000 0,1218 3,789

Lisätiedot

Globaali keskinäisriippuvuus kasvavat jännitteet

Globaali keskinäisriippuvuus kasvavat jännitteet Globaali keskinäisriippuvuus ja kasvavat jännitteet kaiken Megatrendit 2016 KENELLÄ ON VISIO? Millaista yhteiskuntaa rakennamme teknologian avulla? "Muuttuuko ihmiskunta enemmän seuraavan 30 vuoden aikana

Lisätiedot

Tilastokeskuksen väestöennusteet

Tilastokeskuksen väestöennusteet Tilastokeskuksen väestöennusteet Kymppi-Moni hankkeen 2. työpaja Markus Rapo, Väestö- ja kuolemansyytilastot Tilastokeskus Esityksessäni Hieman historiaa Miksi ennusteita laaditaan Tilastokeskuksen väestöennusteen

Lisätiedot

Taittuuko lama Suomessa ja maailmalla?

Taittuuko lama Suomessa ja maailmalla? Taittuuko lama Suomessa ja maailmalla? Turku 19.11.2009 Maailmantalous on elpymässä Entisten tuotantomäärien saavuttaminen vie aikaa Velkaelvytys ajaa monen maan julkisen sektorin rahoituskriisiin 1 US

Lisätiedot

Vertailuun sisältyvät maat

Vertailuun sisältyvät maat Suomen materiaalitehokkuus - Suomen Teollisen ekologian forum Oulu Miksi Suomen materiaalitehokkuus on kansainvälisissä vertailuissa niin heikko? Ilmo Mäenpää & Petri Kyröläinen Thule-instituutti, Oulun

Lisätiedot

organisaatiotasot molekyylitasolta biosfääriin ökunnan monimuotoisuutta ja ymmärtämään eliöiden sopeutumisen erilaisiin ympäristöihin irteet

organisaatiotasot molekyylitasolta biosfääriin ökunnan monimuotoisuutta ja ymmärtämään eliöiden sopeutumisen erilaisiin ympäristöihin irteet BIOLOGIA Biologia on luonnontiede, joka tutkii elollisen luonnon rakennetta, toimintaa ja vuorovaikutussuhteita molekyyli- ja solutasolta biosfääriin. Biologialle tieteenä on ominaista havainnointiin ja

Lisätiedot

Aikuisten TNO -toiminnan ennakointi. Päivi Holopainen Ennakointikoordinaattori, Lapin liitto

Aikuisten TNO -toiminnan ennakointi. Päivi Holopainen Ennakointikoordinaattori, Lapin liitto Aikuisten TNO -toiminnan ennakointi Päivi Holopainen Ennakointikoordinaattori, Lapin liitto 28.3.2014 Mitä on ennakointi? SUUNNITTELU ENNAKOINTI VERKOSTOI- TUMINEN TULEVAI- SUUDEN- TUTKIMUS Lähde: Euroopan

Lisätiedot

Seitsemännen vuosiluokan maantiedossa tutustutaan maapallon karttakuvaan, erityisesti Pohjois- ja Etelä-Amerikkaan.

Seitsemännen vuosiluokan maantiedossa tutustutaan maapallon karttakuvaan, erityisesti Pohjois- ja Etelä-Amerikkaan. 1 Ylöjärven opetussuunnitelma 2004 Maantieto Maantiedon opetuksessa tutkitaan maapalloa ja sen erilaisia alueita sekä alueellisia ilmiöitä. Opetuksen tulee kehittää oppilaiden maantieteellistä maailmankuvaa

Lisätiedot

Lopuksi, muttei hallinnon - suuntia huomiselle

Lopuksi, muttei hallinnon - suuntia huomiselle Lopuksi, muttei hallinnon - suuntia huomiselle Osastopäällikkö, valtion työmarkkinajohtaja Juha Sarkio Henkilöstö- ja hallintopolitiikkaosasto Kaikki johtajat ovat toivon jakajia 09.11.2015 2 Millä näkemyksellä

Lisätiedot

Tervetuloa Halkokarin koulun vanhempainiltaan

Tervetuloa Halkokarin koulun vanhempainiltaan Tervetuloa Halkokarin koulun vanhempainiltaan 5.9.2016 Opetussuunnitelma = OPS Opetussuunnitelma on suunnitelma siitä, miten opetus järjestetään. Se on kaiken koulun opetuksen ja toiminnan perusta. Opetussuunnitelmassa

Lisätiedot

TUKIMATERIAALI: Arvosanan kahdeksan alle jäävä osaaminen

TUKIMATERIAALI: Arvosanan kahdeksan alle jäävä osaaminen MAANTIETO Maantiedon päättöarvioinnin kriteerit arvosanalle 8 ja niitä täydentävä tukimateriaali Opetuksen tavoite Sisältöalueet Maantieteellinen tieto ja ymmärrys T1 tukea oppilaan jäsentyneen karttakuvan

Lisätiedot

Biologia. Maantieto Maantiede

Biologia. Maantieto Maantiede Ympäristö- ja luonnontieto Biologia Maantieto Maantiede Perusopetuksen yleisten tavoitteiden ja tuntijaon uudistustyöryhmän kokous 29.10.2009 Lea Houtsonen Opetushallitus lea.houtsonen@oph.fi Ympäristö-

Lisätiedot

ILMASTONMUUTOS. Erikoiseurobarometri (EB 69) kevät 2008 Euroopan parlamentin / Euroopan komission kyselytutkimus Tiivistelmä

ILMASTONMUUTOS. Erikoiseurobarometri (EB 69) kevät 2008 Euroopan parlamentin / Euroopan komission kyselytutkimus Tiivistelmä Viestinnän pääosasto KANSALAISMIELIPITEEN SEURANNAN YKSIKKÖ Bryssel, 15/10/2008 ILMASTONMUUTOS Erikoiseurobarometri (EB 69) kevät 2008 Euroopan parlamentin / Euroopan komission kyselytutkimus Tiivistelmä

Lisätiedot

Mitä teollisuus ja työelämä odottaa koululaitokselta? Itä-Suomen rehtori- ja johtajuuspäivät Toimitusjohtaja Timo Saarelainen

Mitä teollisuus ja työelämä odottaa koululaitokselta? Itä-Suomen rehtori- ja johtajuuspäivät Toimitusjohtaja Timo Saarelainen Mitä teollisuus ja työelämä odottaa koululaitokselta? Itä-Suomen rehtori- ja johtajuuspäivät 4.9.2014 Toimitusjohtaja Timo Saarelainen Globaalin liiketoiminnan näkökulma Timo Saarelainen toimii Green Fuel

Lisätiedot

Liike-elämän ratkaisut Miten yritykset hillitsevät ilmastonmuutosta?

Liike-elämän ratkaisut Miten yritykset hillitsevät ilmastonmuutosta? Liike-elämän ratkaisut Miten yritykset hillitsevät ilmastonmuutosta? 1 Nykymenolla tulemme ylittämään maapallon kestokyvyn 2.5 4 kertaisesti Käytämme nyt maapallon resursseja 1.5 kertaisesti sen mitä se

Lisätiedot

Sisäisen turvallisuuden ja Ulko- ja turvallisuuspoliittinen selonteko Talousvaliokunta,

Sisäisen turvallisuuden ja Ulko- ja turvallisuuspoliittinen selonteko Talousvaliokunta, Sisäisen turvallisuuden ja Ulko- ja turvallisuuspoliittinen selonteko Talousvaliokunta, 30.9.2016 Jarno Limnéll Professori, kyberturvallisuus, Aalto-yliopisto Kyberturvallisuusjohtaja, Insta Group Oy.

Lisätiedot

YRITTÄJÄTESTIN YHTEENVETO

YRITTÄJÄTESTIN YHTEENVETO YRITTÄJÄTESTIN YHTEENVETO Alla oleva kaavio kuvastaa tehdyn testin tuloksia eri osa-alueilla. Kaavion alla on arviot tilanteestasi koskien henkilökohtaisia ominaisuuksiasi, kokemusta ja osaamista, markkinoita

Lisätiedot

GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE. Merja Veteläinen Boreal Kasvinjalostus Oy

GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE. Merja Veteläinen Boreal Kasvinjalostus Oy GEENIVARAT OVAT PERUSTA KASVINJALOSTUKSELLE Merja Veteläinen Boreal Kasvinjalostus Oy OPIT TÄNÄÄN Miksi kasvinjalostus tarvitsee geenivaroja? Miten geenivaroja käytetään kasvinjalostuksessa? Geenivarat

Lisätiedot

VANHA OPS. valtakunnalliset pakolliset ja syventävät. Hyvinvointi ja ihmissuhteet

VANHA OPS. valtakunnalliset pakolliset ja syventävät. Hyvinvointi ja ihmissuhteet ÄIDINKIELI JA KIRJALLISUUS ENGLANTI RUOTSI B3-KIELET kurssit: ÄIa8 + ÄIa1 osittain ÄaI5 osittain ÄIa2 ÄI1 Tekstit ja vuorovaikutus ENAa1 ENA1 ÄI2 ÄI3 Kieli, kulttuuri ja identiteetti Kirjallisuuden keinoja

Lisätiedot

MUUTTUVA MARKKINA ja MAAILMA 17.3.2011 Aluepäällikkö Päivi Myllykangas, Elinkeinoelämän keskusliitto, EK

MUUTTUVA MARKKINA ja MAAILMA 17.3.2011 Aluepäällikkö Päivi Myllykangas, Elinkeinoelämän keskusliitto, EK Lisää tähän otsikko MUUTTUVA MARKKINA ja MAAILMA 17.3.2011 Aluepäällikkö Päivi Myllykangas, Elinkeinoelämän keskusliitto, EK KANSANTALOUS VÄESTÖKEHITYS JA TUOTTAVUUS Kestävyysvaje aiempaakin suurempi:

Lisätiedot

1 Miksi tarvitsemme kestävää kehitystä?

1 Miksi tarvitsemme kestävää kehitystä? Kestävä kehitys Kelassa 2012 Sisältö 1 Miksi tarvitsemme kestävää kehitystä? 3 Painopisteenä kestävyys 3 Ohjelman perusta ja tavoite 3 Yhteinen globaali haaste 3 Kestävyys on monien asioiden summa 4 2

Lisätiedot

Luonnontieteilijät työnhakijoina

Luonnontieteilijät työnhakijoina Luonnontieteilijät työnhakijoina TEM-info 25.11.2015 Suvi Liikkanen Luonnontieteiden Akateemisten Liitto LAL ry. Webinaarin sisältö Taustaa luonnontieteilijöistä ja Luonnontieteiden Akateemisten Liiton

Lisätiedot

Uusi opetussuunnitelma oppiva yhteisö Etelä- Suomen aluehallintovirasto Karkkila. Ulla Rasimus PRO koulutus ja konsultointi

Uusi opetussuunnitelma oppiva yhteisö Etelä- Suomen aluehallintovirasto Karkkila. Ulla Rasimus PRO koulutus ja konsultointi Uusi opetussuunnitelma oppiva yhteisö Etelä- Suomen aluehallintovirasto 14.- 15.9.2015 Karkkila Ulla Rasimus PRO koulutus ja konsultointi Koulua ympäröivä maailma muuttuu Teknologia Ilmastonmuutos, luonto

Lisätiedot

BIOLÄÄKETIETEEN LÄPIMURROT

BIOLÄÄKETIETEEN LÄPIMURROT BIOLÄÄKETIETEEN LÄPIMURROT Jussi Huttunen Tampere 20.4.2016 LÄÄKETIETEEN MEGATRENDIT Väestö vanhenee ja sairauskirjo muuttuu Teknologia kehittyy - HOITOTEKNOLOGIA - tietoteknologia Hoito yksilöllistyy

Lisätiedot

Kemia. Kemia Tutkii luontoa, sen rakenteita. Tutkii ainetta, sen koostumusta. sekä reaktioita. Eli kuinka aine muuttuu toiseksi aineeksi.

Kemia. Kemia Tutkii luontoa, sen rakenteita. Tutkii ainetta, sen koostumusta. sekä reaktioita. Eli kuinka aine muuttuu toiseksi aineeksi. Tutkii luontoa, sen rakenteita ja ilmiöitä. Tutkii ainetta, sen koostumusta ja ominaisuuksia sekä reaktioita. Eli kuinka aine muuttuu toiseksi aineeksi. 1. oppiaineena ja tieteen alana 2. n opetuksen tavoitteet,

Lisätiedot

Kohti tulevaisuuden terveyspalvelujärjestelmää

Kohti tulevaisuuden terveyspalvelujärjestelmää Kohti tulevaisuuden terveyspalvelujärjestelmää Sanna Salanterä ja Heikki Korvenranta 16.09.2009 Kansallisen terveydenhuollon järjestämisestä vuoteen 2015 Alueellinen organisaatio ja järjestäminen Terveyden

Lisätiedot

tiedeyliopisto Monipuoliset, joustavat opintopolut yhteiskehittämisen

tiedeyliopisto Monipuoliset, joustavat opintopolut yhteiskehittämisen TAMPERE3: VISIO 2025 Visiona on synnyttää tamperelaiset korkeakoulut yhdistävä uusi kansainvälisesti vaikuttava tiedeyliopisto, joka luo uutta osaamista ja ennennäkemättömiä mahdollisuuksia monialaisiin

Lisätiedot

Market Report / November 2011

Market Report / November 2011 Market Report / 211 Nights in unchanged The growth in nights that had continued throughout the year practically came to an end in. The increase compared with the year before was only.3%. Domestic nights

Lisätiedot

Kestävän kehityksen asiantuntijapaneelin viestit

Kestävän kehityksen asiantuntijapaneelin viestit Kestävän kehityksen asiantuntijapaneelin viestit Ilmastonmuutokseen sopeutuminen sosiaalisena ja yhteiskuntaa läpäisevänä tehtävänä Jukka Noponen ja Juho Saari 22.4.2014 Asiantuntijapaneeli kokoontunut

Lisätiedot

Hyvinvointiyhteiskunnan tulevaisuus historian valossa

Hyvinvointiyhteiskunnan tulevaisuus historian valossa Hyvinvointiyhteiskunnan tulevaisuus historian valossa Pauli Kettunen Helsingin yliopisto Politiikan ja talouden tutkimuksen laitos Kestävä hyvinvointi -seminaari Helsingin yliopisto 10.4.2013 Halusimme

Lisätiedot

Talouskurin ja säästäväisyyspolitiikan vaikutuksia eurooppalaisten hyvinvointiin. TELA-seminaari 24.1. 2014. OLLI KANGAS olli.kangas@kela.

Talouskurin ja säästäväisyyspolitiikan vaikutuksia eurooppalaisten hyvinvointiin. TELA-seminaari 24.1. 2014. OLLI KANGAS olli.kangas@kela. Talouskurin ja säästäväisyyspolitiikan vaikutuksia eurooppalaisten hyvinvointiin TELA-seminaari 24.1. 214 OLLI KANGAS olli.kangas@kela.fi Esityksen sisältö Mitä on hyvinvointi Taloudelliset raunaehdot

Lisätiedot

KVS2008. Pertti Kuronen

KVS2008. Pertti Kuronen Pertti Kuronen 15.3.2007 1 Pertti Kuronen 15.3.2007 Tariffirakenne ja alustava hintataso KVS2005 toteutuminen KVS2008 lähtökohdat tariffirakenne alustava hintataso alustavat yksikköhinnat 2 Pertti Kuronen

Lisätiedot

Market Report / December

Market Report / December Market Report / December Nights in Helsinki down 6% in December while the total 212 numbers stayed the same as last year Nights in Helsinki were down 6.1% in December. Domestic nights declined by 8.5%,

Lisätiedot