Tuoretta tietoa Etelä-Savon taimenkannoista

Save this PDF as:
 WORD  PNG  TXT  JPG

Koko: px
Aloita esitys sivulta:

Download "Tuoretta tietoa Etelä-Savon taimenkannoista"

Transkriptio

1 Tuoretta tietoa Etelä-Savon taimenkannoista Jorma Piironen Luke, Joensuu Esityksen aiheet Tutkitut taimennäytteet Mitä DNA-analyysit kertovat Heinäveden reitin taimenkanta Miten taimenistutukset onnistuvat (Pielinen, Höytiäinen, Pyhäselkä)? Miten taimenta kalastetaan? Suojaako alamitta taimenta? Miten eteenpäin? 2 Jorma Piironen 1

2 Mäntyharjun reitin koskialueita Heinäveden reitin koskialueita Läsäkoski Karvionkoski Kermankosket, Haapakoski, Vihonvuonne Pilpankosket Ripatinkoski Kissakoski Puuskankoski Kaivannonkoski Pyhäkoski 3 Jorma Piironen Tutkitut näytteet Mäntyharjun reitti paikka Vuosi näytemäärä näyte Läsäkoski poikaset Tuhankoski(3) Ripatink. (42) 2011, 45 poikaset Puuskankoski 2011, Pyhäkoski (22) Kaivannonk. (10) Volaj. Esalank. (2) 15 poikaset 34 poikaset yhteensä Jorma Piironen 2

3 Heinäveden reitti paikka vuosi näytemäärä näyte Kermankosket (27) Haapakoski (36) Vihonvuonne (19) Pilpankoski (22) 2012, 104 poikaset Kermankosket Kermankosket (emoparvikasvatus Enonkoskella) Karvionkosket 2012, yhteensä emokalat 66 poikaset 65 poikaset 5 Jorma Piironen vesistö paikka vuosi näytemäärä näyte Pielisjoki Kuurna Ala-Koitajoki Hiiskoski (47) Lohikoski, Tiaisenkoski, Tyltsy 2011, Lieksanjoki Lieksankoski emokalat 78 poikaset 80 emokalat Lieksanjoki poikaset Lieksanjoki Hanhijoki (52) Ulkkajoki (4) poikaset Lieksanjoki Saarijoki poikaset yhteensä Jorma Piironen 3

4 Mikrosatelliitti geeni CA Heterotsygoottinen yksilö: TGCCAATTCGCACACACACATGTGACTGG TGCCAATTCGCACACACACACACATGTGACTGG DNA-kaksoiskierre Homotsygoottinen yksilö: TGCCAATTCGCACACACATGTGACTGG TGCCAATTCGCACACACATGTGACTGG RKTL/Joensuu DNA-tutkimus, mikrosatelliitit > laskentaohjelmat 16 mikrosatelliitia, 935 taimenta geenimuotojen (alleelien) määrä oli 202 Alleelien määrä/15 yksilöä/näytepaikka Alleelien määrä/71 yksilöä/ reitti (tai isompi vesialue) Keskimääräinen alleelimäärä oli 5,7 alleeli/15 yksilö Keskiarvoa pienempi Läsäkoski ja Puuskankoski (Lieksanjoen sivupurot) Vesistöaluettain suurin Mäntyharjun reitillä,: 9,2 alleelia/ 71 yksilöä 8 Jorma Piironen 4

5 Laskettuja tunnuslukuja Reitti Koski/virta-alue N N all All rik. (15) All rik. (71) Keskim. div Mäntyharjunreitti Läsäkoski ,5 0,62-0,052 Mäntyharjunreitti Tuhankoski (3), ,7 0,66-0,053** Ripatinkosket (42) Mäntyharjunreitti Puuskankoski ,8 0,59-0,027 Mäntyharjunreitti Pyhäkoski (22), Kaivannonk. (10), VolanjoenEsala (2) ,0 0,70-0,014 Yhteensä ,2 0,69 0,014 Heinävedenreitti Kermankoski (27), ,1 0,71 0,003 Pilpankoski (22), Vihonvuonne (19), Haapakoski (36) Heinävedenreitti Kermankoski, emot ,2 0,71 0,009 Heinävedenreitti Kermankoski, Enonk ,0 0,71 0,001 emok. Heinävedenreitti Karvionkosket ,0 0,72-0,023 Yhteensä ,8 0,72 0,008 Fst *** 9 Jorma Piironen Näytepopulaatioden perinnölliset etäisyydet (juureton sukupuu) Mäntyh. Pyhäkoski Mäntyh. Kaivannonk. Lieksa Lieksanjoki Mäntyh. Ripatinkoski Heinäv. Karvionkosket Ala-Koitajoki Lieksanjoki emot Pielisjoki Kuurna emot Mäntyh. Läsäkoski Mäntyh. Puuskankoski Heinäv. Kerma Vihonvuonne Heinäv. Kerma emot Heinäv. Kerma poikaset Enonk. 10 Jorma Piironen 5

6 Taimenten sukupuu? 11 Jorma Piironen Viitearvot Sukulaisuus, efektiivinen koko Mäntyharjun reitti >50 >0,5 >50 <0,04 N Ne 95% CI Ne/N Perheitä Sukul. aste Läsäkoski , ,040 Tuhankoski (3), Ripatinkosket (42) , ,051 Puuskankoski , ,055 Pyhäkoski (22), Kaivannonkosket (10), Volanjoen Esalankoski(2) , ,068 Yhteensä

7 Viitearvot Sukulaisuus, efektiivinen koko Heinäveden reitti Kermankoski (27), Pilpankoski(22), Vihonvuonne (19), Haapakoski (36) >50 >0,5 >50 <0,04 N Ne 95% CI Ne/N Perheitä Sukul. aste , ,047 Kermankoski, emot, 220 0,035 Kermankoski, poikaset, Enonk , ,040 Karvionkosket ,4 38 0,058 Yhteensä Jorma Piironen 13 Emokalasto Kermankoskista pyydetyistä poikasista ja sähkökalastetut poikaset Siirrettiin Enonkoskelle emokalastokasvatukseen eristysosasto 2014 yksilöllinen PIT-merkintä ja DNA-näytteet tuoduissa 5 järvilohen poikasta (0+) 1 järvilohen ja taimenen risteymä risteymiä myös emokalanäytteissä: 4 kpl ( kpl, 2006 ja 2007: suurin 73,5 cm 4,8 kg kuollut koiras) 14 Jorma Piironen 7

8 DNA-analyysien tulokset poikasista emoparveksi poikaset (66 kpl) 26 naaraan ja 30 koiraan jälkeläisiä 59 eri perheestä sukulaisuusaste 4% efektiivinen koko 68 usealla naaraalla ja koiraalla useampia partnereita (enimmillään 4) >perinnöllisesti monimuotoisempi kuin kututaimenista perustettu emoparvi 15 Jorma Piironen Viljelyparvien perustamisessa käytetyt naarastaimenet (RKTL) Kermankoski Lieksanjoki Pielisjoki taimenia, kpl Jorma Piironen 8

9 Miten taimenistutukset onnistuvat? Merkintäerät järvialue Ikä määrä eriä palautus-% (vaihteluv.) saalis kg/1000 Pielinen 2-v ,7 (0,3-1,8) 8 (2-19) Pielinen 3-v ,1 (2,1-10,9) 78 (17-149) Pyhäs. Pielisjoki 2-v ,1 (0-0,4) 1 (0-0,7) Pyhäs. Pielisjoki 3-v ,4 (0,8-1,4) 18 (7-29) Höytiäinen 2-v ,4 (9,9-17,7) 214 ( ) Höytiäinen 3-v ,6 (26-38,1) 462 ( ) 17 Jorma Piironen Millä taimenet kalastetaan PIE, HÖY, PIJ, Pyhäselkä palautusta % palautuksista v JT 3-v JT verkot 76,4 76,9 vapa 15,9 14,9 ei ilm. 7,7 8,2 18 Jorma Piironen 9

10 Toimiiko 50 cm alamitta? 60 osuus palautetuista, % alle 50 cm yli 50 cm verkot 42,9 35,3 vapa 6,7 8,9 ei ilm. 3,9 2,4 19 Jorma Piironen Entä jos alamitta olisi ollut 60 cm? 7,2 alle 60 cm yli 60 cm 92,8 20 Jorma Piironen 10

11 Mitä pitäisi tehdä heti? viimeiset villit taimenet säästettävä kokonaan kalastukselta ja turvattava niiden lisääntyminen luonnossa > tärkeät taimenalueet = nykyiset lisääntymisalueet taimenelle lisää kutukoskia (mm. Palokki) verkkokalastuksen ja muun kalastuksen ongelmiin puututtava > tehokkaammat kalastusjärjestelyt taimenen emokalastoja myös pienpoikasista > viljelystä ensisijaisesti kalastettaviksi tarkoitettuja istukkaita poikastuotantomenetelmät uusiksi luomu, virikekasvatus? Kiitos! 22 Jorma Piironen 11

Lohikalojen merkintähankkeiden tuloksia

Lohikalojen merkintähankkeiden tuloksia Lohikalojen merkintähankkeiden tuloksia Jorma Piironen Luke, Joensuu Pohjois-Karjalan kalastusaluepäivät 17.3.217 Huhmari 1 JP/Huhmari Esityksen sisältö Palautusten kehittyminen Pielisjoki, Pielinen Järvialtaiden

Lisätiedot

Taimenkantojen tila ja istutusten tuloksellisuus - Vuoksen vesistöt

Taimenkantojen tila ja istutusten tuloksellisuus - Vuoksen vesistöt Taimenkantojen tila ja istutusten tuloksellisuus - Vuoksen vesistöt Jorma Piironen, RKTL Joensuu Kuopio Iso-Valkeinen 19.4.2011 VUOKSEN VESISTÖN TAIMEN? EI (TARKKOJA tai KATTAVIA) TIETOJA Luontainen lisääntyminen?

Lisätiedot

Järvilohen tilanne katsaus hankkeisiin

Järvilohen tilanne katsaus hankkeisiin Järvilohen tilanne katsaus hankkeisiin Jorma Piironen LUKE Joensuu 1 JP/Joensuu Voimalat ja padot Pielisjoessa ja Ala-Koitajoessa Hiiskosken pato 1955 Kaltimo 1958 Pamilo 1955 Kuurna 1971 Joki MQ, m 3

Lisätiedot

Järvitaimenen ja lohen merkintätutkimukset Etelä-Savossa vuosina

Järvitaimenen ja lohen merkintätutkimukset Etelä-Savossa vuosina Järvitaimenen ja lohen merkintätutkimukset Etelä-Savossa vuosina 2012-14 Merkkipalautukset 31.12.2014 mennessä, Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011-14 Etelä-Savon kalastusaluepäivä

Lisätiedot

Järvilohen säilyttämisen näkymät?

Järvilohen säilyttämisen näkymät? Järvilohen säilyttämisen näkymät? Jorma Piironen LUKE Joensuu Vesistökunnostusverkosto vuosiseminaari 2018, Oulu 1 Esityksen sisältö Järvilohen nykytila Säilyttäminen viljelemällä ja istuttamalla Kalastus

Lisätiedot

ALA-KOITAJOKI JA JÄRVILOHI - ENNEN JA JÄLKEEN LISÄVESITYKSEN Jorma Piironen RKTL/Joensuu. Tietoa kestäviin valintoihin

ALA-KOITAJOKI JA JÄRVILOHI - ENNEN JA JÄLKEEN LISÄVESITYKSEN Jorma Piironen RKTL/Joensuu. Tietoa kestäviin valintoihin ALA-KOITAJOKI JA JÄRVILOHI - ENNEN JA JÄLKEEN LISÄVESITYKSEN 1.9.2011 Jorma Piironen RKTL/Joensuu Ala-Koitajoki ja järvilohen ja taimenen poikaset > MITÄ TEHTY? Koeistutuksia v:sta 1983, säännöllisemmin

Lisätiedot

Taimenkantojen tila Suomessa - erityisesti Vuoksen vesistössä ja Keski-SuomessaT

Taimenkantojen tila Suomessa - erityisesti Vuoksen vesistössä ja Keski-SuomessaT Taimenkantojen tila Suomessa - erityisesti Vuoksen vesistössä ja Keski-SuomessaT Jorma Piironen, RKTL Joensuu Pentti Valkeajärvi, RKTL Jyväskylä jokialue Järvitaimenen esiintyminen Vuoksen vesistössä (Mäkinen

Lisätiedot

Jorma Piironen, RKTL Liperi

Jorma Piironen, RKTL Liperi Jorma Piironen, RKTL Liperi 15.4.2014 Miksi äärimmäisen uhanalainen? kärsinyt jokien ruoppauksista, kanavoinnista, puun uitosta, liiallisesta kalastuksesta vesivoimaloiden rakentaminen 1950- ja 1970-luvuilla

Lisätiedot

Lieksanjoki, Ala-Koitajoki ja Pielisjoki järvilohen ja taimenen palauttamishankkeet

Lieksanjoki, Ala-Koitajoki ja Pielisjoki järvilohen ja taimenen palauttamishankkeet Lieksanjoki, Ala-Koitajoki ja Pielisjoki järvilohen ja taimenen palauttamishankkeet Jorma Piironen LUKE Joensuu 1 JP/Joensuu Paljonko on riittävästi järvilohen elinkierron syntymiseksi? Paljonko emolohia

Lisätiedot

Säilyykö järvilohi kalastossamme?

Säilyykö järvilohi kalastossamme? Säilyykö järvilohi kalastossamme? Jorma Piironen LUKE Joensuu Suomen Kalakirjaston juhlaseminaari 23.11.2017 Muonio 1 Esityksen sisältö Oi niitä aikoja. Miksi järvilohella menee heikosti Miten säilytys

Lisätiedot

Kemijoen Sihtuunan ja Rautuojan taimenten geneettinen analyysi Jarmo Koskiniemi, Helsingin yliopisto, maataloustieteiden osasto

Kemijoen Sihtuunan ja Rautuojan taimenten geneettinen analyysi Jarmo Koskiniemi, Helsingin yliopisto, maataloustieteiden osasto 21.12.2018 Kemijoen Sihtuunan ja Rautuojan taimenten geneettinen analyysi Jarmo Koskiniemi, Helsingin yliopisto, maataloustieteiden osasto Näytteet Jarmo Huhtala toimitti syksyllä 2018 Helsingin yliopiston

Lisätiedot

Vaelluskalafoorumi Hki. Jorma Piironen, RKTL

Vaelluskalafoorumi Hki. Jorma Piironen, RKTL Jorma Piironen, RKTL Taustatietoja Ala-Koitajoesta ja järvilohesta Entinen järvilohen kutujoki Ainakin 1940-luvulta lähtien tunnistettu lohi (alavetinen) ja taimen (ylävetinen) Järvilohen viljelykokeilut

Lisätiedot

Vuoksen vesistön järvitaimenen toimenpideohjelma. Vesistökunnostusverkoston seminaari

Vuoksen vesistön järvitaimenen toimenpideohjelma. Vesistökunnostusverkoston seminaari Vuoksen vesistön järvitaimenen toimenpideohjelma Vesistökunnostusverkoston seminaari 12.6..2014 Timo Takkunen, Pohjois-Savon ELY-keskus 16.6.2014 1 Vuoksen järvitaimenen nykytila Erittäin uhanalainen Kantojen

Lisätiedot

Pielisen ja Höytiäisen järvilohi- ja taimenmerkintöjen tulokset v. 2008-2010 istukaseristä

Pielisen ja Höytiäisen järvilohi- ja taimenmerkintöjen tulokset v. 2008-2010 istukaseristä ISTUTETAANKO TURHAAN? Pielisen ja Höytiäisen järvilohi- ja taimenmerkintöjen tulokset v. 2008-2010 istukaseristä Jorma Piironen RKTL Joensuu Lohikalaistutuksilla tavoitellaan kalastettavaa kalakantaa.

Lisätiedot

Jorma Piironen, RKTL. Pohjois-Karjalan kalastusaluepäivät 2014 Huhmari, Polvijärvi

Jorma Piironen, RKTL. Pohjois-Karjalan kalastusaluepäivät 2014 Huhmari, Polvijärvi Jorma Piironen, RKTL Pohjois-Karjalan kalastusaluepäivät 2014 Huhmari, Polvijärvi Taustatietoja Ala-Koitajoesta ja järvilohesta Entinen järvilohen kutujoki Ainakin 1940-luvulta lähtien tunnistettu lohi

Lisätiedot

RAPORTTEJA Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma

RAPORTTEJA Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma RAPORTTEJA 60 2018 Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma JÄRVITAIMENTYÖRYHMÄ: TIMO TAKKUNEN PUH.JOHT., POHJOIS-SAVON ELY-KESKUS

Lisätiedot

JÄRVILOHISTRATEGIA. Saimaan järvilohikannan säilymisen ja kestävän käytön turvaaminen

JÄRVILOHISTRATEGIA. Saimaan järvilohikannan säilymisen ja kestävän käytön turvaaminen JÄRVILOHISTRATEGIA Saimaan järvilohikannan säilymisen ja kestävän käytön turvaaminen Strategian tavoite ja päämäärä Strategian tavoitteena on turvata Saimaan järvilohikannan olemassaolo, perinnöllisen

Lisätiedot

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 Etelä-Savon ELY-keskuksen kalatalousryhmän hallinnoima EU:n osarahoitteinen hanke (50 %). Hankkeen kustannusarvio on noin 600 000 euroa.

Lisätiedot

Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma RAPORTTEJA XX 2017

Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma RAPORTTEJA XX 2017 Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma RAPORTTEJA XX 2017 RAPORTTEJA xx 201X Vuoksen vesistöalueen järvitaimenkantojen toimenpideohjelma Pohjois-Savon elinkeino-, liikenne- ja ympäristökeskus

Lisätiedot

Ajankohtaista nieriäkannan hoitamisesta

Ajankohtaista nieriäkannan hoitamisesta Ajankohtaista nieriäkannan hoitamisesta Irma Kolari ja Esa Hirvonen Luonnonvarakeskus Enonkoski 2.2.2017, Mikkeli Nieriä Suomessa Pioneerilaji, levittäytyi jo jääkauden aikaisiin jääjärviin Atlanttinen

Lisätiedot

Vuoksen vesistön järvitaimenen toimenpideohjelma. Etelä-Savon kalastusaluepäivä

Vuoksen vesistön järvitaimenen toimenpideohjelma. Etelä-Savon kalastusaluepäivä Vuoksen vesistön järvitaimenen toimenpideohjelma Etelä-Savon kalastusaluepäivä 3.12.2015 Timo Takkunen, Pohjois-Savon ELY-keskus 7.12.2015 1 Taimenkantojen hoito-ohjelma Uusi kalastuslaki kalakantojen

Lisätiedot

Ehdotus kalastuksen järjestämisestä Savonlinnan kaupunki

Ehdotus kalastuksen järjestämisestä Savonlinnan kaupunki Ehdotus kalastuksen järjestämisestä Savonlinnan kaupunki Sisällysluettelo 1. UHANALAISET KOHDELAJIT... 4 1.1 Järvilohi... 4 1.2 Järvitaimen... 4 2. TOIMENPITEET... 5 2.1 Lohikalojen nousuväylä... 5 3.

Lisätiedot

Taimenkantojen tila ja istutusten tuloksellisuus Rautalammin reitillä. Pentti Valkeajärvi Riista- ja kalatalouden tutkimuslaitos

Taimenkantojen tila ja istutusten tuloksellisuus Rautalammin reitillä. Pentti Valkeajärvi Riista- ja kalatalouden tutkimuslaitos Taimenkantojen tila ja istutusten tuloksellisuus Rautalammin reitillä Pentti Valkeajärvi Riista- ja kalatalouden tutkimuslaitos Kuopio19.4.2011 Rautalammin reitti Keski-Suomen taimenkantojen hoitostrategiaa

Lisätiedot

15.5.2012. www.jarvilohi.fi 15.5.2012

15.5.2012. www.jarvilohi.fi 15.5.2012 15.5.2012 15.5.2012 Hankkeen yleistavoite Hankkeen yleistavoitteena on Saimaan arvokkaiden lohikalakantojen perinnöllisen monimuotoisuuden säilyttäminen ja kantojen tilan paraneminen kestävää kalastusta

Lisätiedot

Istukkaitten ja villien taimenten vaellukset Keski-Suomessa. Kalastusaluepäivä 13.12.2013 Pentti Valkeajärvi Konneveden kalatutkimus ry

Istukkaitten ja villien taimenten vaellukset Keski-Suomessa. Kalastusaluepäivä 13.12.2013 Pentti Valkeajärvi Konneveden kalatutkimus ry Istukkaitten ja villien taimenten vaellukset Keski-Suomessa Kalastusaluepäivä 13.12.2013 Pentti Valkeajärvi Konneveden kalatutkimus ry Vaellustieto perustuu merkintöihin ja vaelluksella olevien pyyntiin

Lisätiedot

Lohikalat Karjaanjoen vesistössä. Ari Saura, Länsi-Uudenmaan vesi ja ympäristö ry:n 40-vuotisjuhlaseminaari , Mustio

Lohikalat Karjaanjoen vesistössä. Ari Saura, Länsi-Uudenmaan vesi ja ympäristö ry:n 40-vuotisjuhlaseminaari , Mustio Lohikalat Karjaanjoen vesistössä Ari Saura, Länsi-Uudenmaan vesi ja ympäristö ry:n 40-vuotisjuhlaseminaari 19.11.2015, Mustio Lohikalatutkimuksia Karjaanjoen vesistössä Karjaanjoki LIFE 2001-2004 Taimenen

Lisätiedot

Riista- ja kalatalouden tutkimuslaitoksen harjuksen emokalastojen geneettinen monimuotoisuus mikrosatelliittianalyysien perusteella

Riista- ja kalatalouden tutkimuslaitoksen harjuksen emokalastojen geneettinen monimuotoisuus mikrosatelliittianalyysien perusteella KALA- JA RIISTARAPORTTEJA nro 367 Teija Aho Jorma Piironen Markku Pursiainen Riista- ja kalatalouden tutkimuslaitoksen harjuksen emokalastojen geneettinen monimuotoisuus mikrosatelliittianalyysien perusteella

Lisätiedot

Saimaannieriä voidaan palauttaa istuttamalla

Saimaannieriä voidaan palauttaa istuttamalla Saimaannieriä voidaan palauttaa istuttamalla Irma Kolari ja Esa Hirvonen RKTL, Enonkoski Saimaannieriä voidaan palauttaa istuttamalla? Irma Kolari ja Esa Hirvonen RKTL, Enonkoski Palautusistutuksia valtion

Lisätiedot

Avain viljeltävien taimen-, harjus- ja siikaemokalastojen geneettiseen tietokantaan Riista- ja kalatalouden tutkimuslaitoksen vesiviljelyssä

Avain viljeltävien taimen-, harjus- ja siikaemokalastojen geneettiseen tietokantaan Riista- ja kalatalouden tutkimuslaitoksen vesiviljelyssä KALA- JA RIISTARAPORTTEJA nro 253 Teija Aho Jorma Piironen Markku Pursiainen Avain viljeltävien taimen-, harjus- ja siikaemokalastojen geneettiseen tietokantaan Riista- ja kalatalouden tutkimuslaitoksen

Lisätiedot

Järvitaimenseminaari Läsäkoski 3.11.2010

Järvitaimenseminaari Läsäkoski 3.11.2010 Järvitaimenseminaari Läsäkoski 3.11.2010 Biologi Teemu Hentinen, Etelä-Savon elinkeino-, liikenne- ja ympäristökeskus, rakentamisyksikkö. Puh. 0400-623207 sähköposti: teemu.hentinen@ely-keskus.fi 1 Esityksen

Lisätiedot

Ehdotus kalastuksen järjestämisestä Kaartilan osakaskunta

Ehdotus kalastuksen järjestämisestä Kaartilan osakaskunta Ehdotus kalastuksen järjestämisestä Kaartilan osakaskunta Sisällysluettelo 1. UHANALAISET LOHIKALAT... 4 1.1 Järvilohi... 4 1.2 Järvitaimen... 4 2. TOIMENPITEET... 5 2.1 Vekaransalmen nousuväylä... 5 3.

Lisätiedot

Kemijoki Oy Keskustelussa Ruunaan KA x x Pielisen KA Varmistunut x

Kemijoki Oy Keskustelussa Ruunaan KA x x Pielisen KA Varmistunut x Vuosi 2016 AJANKOHTA RAHOITUS LAJIT TOIMENPIDE TYYPPI ALKAA PÄÄTTYY KOHDE KOK.KUSTANNUS KÄRKIHANKE MUU LÄHDE TILANNE TOTEUTTAJAT JL TVI KUVAUS / VAIKUTTAVUUS / HUOMIOITA Valmistelu Koordinointi helmikuu

Lisätiedot

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 Etelä-Savon ELY-keskuksen kalatalousryhmän hallinnoima EU:n osarahoitteinen hanke (50 %). Hankkeen kustannusarvio on noin 600 000 euroa.

Lisätiedot

ISOJOEN JA KAUHAJOEN ALUEEN TAIMENTEN GENEETTISET TUTKIMUKSET JA HOITOSUOSITUKSET

ISOJOEN JA KAUHAJOEN ALUEEN TAIMENTEN GENEETTISET TUTKIMUKSET JA HOITOSUOSITUKSET ISOJOEN JA KAUHAJOEN ALUEEN TAIMENTEN GENEETTISET TUTKIMUKSET JA HOITOSUOSITUKSET Taimenpäivä 12.12.2016 Isojoki Kodesjärven kylätalo Eero Jutila Nettiosoite http://jukuri.luke.fi/bitstream/handle/10024/519534/lukeluobio_52_2015.pdf?sequence=1

Lisätiedot

Pelastaako ympäristövirtaama järvilohen? Jorma Piironen, RKTL

Pelastaako ympäristövirtaama järvilohen? Jorma Piironen, RKTL Pelastaako ympäristövirtaama järvilohen? Jorma Piironen, RKTL Sisältö: Järvilohikannan nykytilanne Hieman historiaa Ala-Koitajoki ja järvilohi Mitä KHO:n päätöksessä sanotaan? Ympäristövirtaama minimivirtaama?

Lisätiedot

Longinoja JUHA SALONEN - OMIA HAJATELMIA

Longinoja JUHA SALONEN - OMIA HAJATELMIA Longinoja JUHA SALONEN - OMIA HAJATELMIA Juha Salonen Syntynyt 1980 Helsingissä Asunut 20v Helsingin Malmilla, nykyään Vantaalla Kasvimaapalsta puron rannalla Opiskellut kalataloutta Savonlinnassa Töissä

Lisätiedot

Pohjois-Karjalan Kalastusaluepäivät Huhmari, Polvijärvi Kari Kujala. Kalanviljelyn kuulumisia

Pohjois-Karjalan Kalastusaluepäivät Huhmari, Polvijärvi Kari Kujala. Kalanviljelyn kuulumisia Pohjois-Karjalan Kalastusaluepäivät 2017 18.3.2017 Huhmari, Polvijärvi Kari Kujala Kalanviljelyn kuulumisia Synkkä vuosi järvilohilla 2016 Emme kyenneet estämään järvilohen poikastappioita keväällä 2016.

Lisätiedot

Vaelluskalalajit ja valtion vesiviljelytoiminta

Vaelluskalalajit ja valtion vesiviljelytoiminta Vaelluskalalajit ja valtion vesiviljelytoiminta Petri Heinimaa Vaelluskalafoorumi, Espoo 24.3.2017 Valtion vesiviljelytoiminta Uhanalaisten kalakantojen säilyttäminen ja elvyttäminen Alkuperältään ja viljelytaustaltaan

Lisätiedot

Kalatalouden neuvontajärjestöt vaelluskalakantojen hoitajina. Kalajoki Tapio Kangas Perämeren Kalatalousyhteisöjen Liitto ry

Kalatalouden neuvontajärjestöt vaelluskalakantojen hoitajina. Kalajoki Tapio Kangas Perämeren Kalatalousyhteisöjen Liitto ry Kalatalouden neuvontajärjestöt vaelluskalakantojen hoitajina Kalajoki 20.11.2017 Tapio Kangas Perämeren Kalatalousyhteisöjen Liitto ry Tässä esityksessä esittelen: Perämeren vaellussiikakantojen hoito

Lisätiedot

Voidaanko taimenkantoja suojella alamittasäädöksin Suomessa? Teuvo Niva RKTL, erikoistutkija, FT

Voidaanko taimenkantoja suojella alamittasäädöksin Suomessa? Teuvo Niva RKTL, erikoistutkija, FT Voidaanko taimenkantoja suojella alamittasäädöksin Suomessa? Teuvo Niva RKTL, erikoistutkija, FT Sisältö Kalastuksen säätelyn yleisiä periaatteita Alamittasäätely Säätelyn toimintaympäristö Alamittasäätely

Lisätiedot

Puulan taimenista ( lohista ) ja vähän muistakin kaloista

Puulan taimenista ( lohista ) ja vähän muistakin kaloista Puulan taimenista ( lohista ) ja vähän muistakin kaloista Timo J. Marjomäki Jyväskylän yliopisto Bio- ja ympäristötieteiden laitos Taimenseminaari Läsäkoski 3.11.2010 (päivitys 4.11.2010) Sisältö Villit

Lisätiedot

Kestävää kalastusta Pielisellä

Kestävää kalastusta Pielisellä Kestävää kalastusta Pielisellä Elämyksellisiä kalastushetkiä toivottaen, Mirko Laakkonen Projektipäällikkö Pielisen järvilohi ja taimen -hanke www.jarvilohi.net Esipuhe Suomessa on lukuisia järviä, jokia

Lisätiedot

EMOKALASTON REAALIAIKAINEN VALINTA JA SUKULAISUUDEN HALLINTAJÄRJESTELMÄ

EMOKALASTON REAALIAIKAINEN VALINTA JA SUKULAISUUDEN HALLINTAJÄRJESTELMÄ EMOKALASTON REAALIAIKAINEN VALINTA JA SUKULAISUUDEN HALLINTAJÄRJESTELMÄ Harri Vehviläinen Juhani Ahon Kalastusperinneseura 7.4.2016 Helsingin Suomalainen Klubi Esitelmän avainkäsitteistä. Emokalasto: lukumäärältään

Lisätiedot

Pielisen Järvilohi ja Taimen 2008 2010 -hanke

Pielisen Järvilohi ja Taimen 2008 2010 -hanke Liite 4 Pielisen Järvilohi ja Taimen 2008 2010 -hanke Sähkökoekalastusraportti 29.1.2009 Timo Hartikainen SISÄLLYSLUETTELO: 1. Johdanto... 2 2. Pyynnin toteutus... 3 3. Kerätty aineisto... 3 4. Kartta:

Lisätiedot

VMK/P-K ELY-keskus

VMK/P-K ELY-keskus VMK/P-K ELY-keskus 26.3.2013 Järvilohen elinalueet Ala-Koitajoen-Pielisjoen kalasto Ala-Koitajoen-Pielisjoen kalastoon ovat luontaisesti kuuluneet mm. harjus, jokikutuinen siika, järvitaimen ja järvilohi.

Lisätiedot

Taimen- ja järvilohi-istutusten merkintäsuunnitelma vuosille 2011-2015

Taimen- ja järvilohi-istutusten merkintäsuunnitelma vuosille 2011-2015 POHJOIS-,ETELÄ JA KESKI-PÄIJÄNTEEN KALASTUSALUEET Taimen- ja järvilohi-istutusten merkintäsuunnitelma vuosille 2011-2015 Tomi Ranta 1, Olli Urpanen 2, Timo Meronen 2 & Jukka Syrjänen 3 Hämeen Kalatalouskeskus

Lisätiedot

Pohjois-Karjalan Kalastusaluepäivät Huhmari, Polvijärvi Kari Kujala. Kalanviljelyn kuulumisia

Pohjois-Karjalan Kalastusaluepäivät Huhmari, Polvijärvi Kari Kujala. Kalanviljelyn kuulumisia Pohjois-Karjalan Kalastusaluepäivät 2018 17.3.2017 Huhmari, Polvijärvi Kari Kujala Kalanviljelyn kuulumisia Vesihometilanne Keskijärvellä ja Kontiolahdessa Vesihome on kiusannut rankalla otteella jo 3

Lisätiedot

LUONNONVARAISET JÄRVITAIMENKANNAT

LUONNONVARAISET JÄRVITAIMENKANNAT LUONNONVARAISET JÄRVITAIMENKANNAT Ari Huusko Riista- ja kalatalouden tutkimuslaitos Aiheina tänään: Luonnonvaraiset järvitaimenkannat Suomessa Taimenen elämänkierto ja ominaisuudet Kuusamon Oulankajoki

Lisätiedot

Puulan kalastusalueen toimintakertomus 2013

Puulan kalastusalueen toimintakertomus 2013 Puulan kalastusalueen toimintakertomus 2013 Mikkeli 2013 1 JOHDANTO Puulan kalastusalue on vesipinta-alaltaan noin 50 000 hehtaaria. Kalastusalueen suurimmat järvet ovat Puula, Ryökäsvesi, Liekune, Synsiä,

Lisätiedot

Ehdotus kalastuksen järjestämisestä Vekara-Lohilahden osakaskunta

Ehdotus kalastuksen järjestämisestä Vekara-Lohilahden osakaskunta Ehdotus kalastuksen järjestämisestä Vekara-Lohilahden osakaskunta Sisällysluettelo 1. UHANALAISET LOHIKALAT... 4 1.1 Harjus... 4 1.2 Järvilohi... 4 1.3 Järvitaimen... 4 2. TOIMENPITEET... 5 2.1 Solmuvälirajoitus...

Lisätiedot

Tutkimustuloksia taimenen järvi-istutuksista Oulujärveltä

Tutkimustuloksia taimenen järvi-istutuksista Oulujärveltä Tutkimustuloksia taimenen järvi-istutuksista Oulujärveltä Pekka Hyvärinen Riista- ja kalatalouden tutkimuslaitos 16.-17.11.2006 Oulun läänin Kalastusaluepäivät, Kuhmo Oulujärven jt-istutukset ja saalis

Lisätiedot

RAKENNETTUJEN JOKIEN KALATALOUDELLE AIHEUTUNEET VAHINGOT JA KALATALOUSVELVOITTEET

RAKENNETTUJEN JOKIEN KALATALOUDELLE AIHEUTUNEET VAHINGOT JA KALATALOUSVELVOITTEET RAKENNETTUJEN JOKIEN KALATALOUDELLE AIHEUTUNEET VAHINGOT JA KALATALOUSVELVOITTEET Kuvat: Simo Yli-Lonttinen VAELLUSKALAFOORUMI OULU 11.2.2014 Aki Mäki-Petäys RKTL Esityksen sisältö RKTL:N TYÖRAPORTTI KALATALOUSVAHINGOISTA-

Lisätiedot

Meritaimen Suomenlahdella

Meritaimen Suomenlahdella Meritaimen Suomenlahdella Merkintäistutusten tuloksia 198-27 Vuoden 24 merkintäeristä tarkemmin Lohimerkintöjen tuloksia Suomenlahden tila Verkkoselektio Järvitaimenseminaari, Äänekoski 29.1.28, Ari Saura,

Lisätiedot

UNELMA uusi viljelylaji nelmasta (Stenodus leucichthys nelma)

UNELMA uusi viljelylaji nelmasta (Stenodus leucichthys nelma) UNELMA uusi viljelylaji nelmasta (Stenodus leucichthys nelma) Petri Heinimaa Riista- ja kalatalouden tutkimuslaitos Nelma-Siika Workshop Laukaa 7.4.2011 RKTL - tietoa kestäviin valintoihin Mikä on Nelma?

Lisätiedot

Puulaveden villi järvitaimen

Puulaveden villi järvitaimen Puulaveden villi järvitaimen Jukka Syrjänen 1,2, Jouni Kivinen 1, Matti Kotakorpi 1,2, Miika Sarpakunnas 1,2, Kimmo Sivonen 1,2, Olli Sivonen 1 & Ilkka Vesikko 1,2 Jyväskylän yliopisto (1), Konneveden

Lisätiedot

Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät

Laboratorioanalyysit, vertailunäytteet ja tilastolliset menetelmät Jarmo Koskiniemi Maataloustieteiden laitos Helsingin yliopisto 0504151624 jarmo.koskiniemi@helsinki.fi 03.12.2015 Kolkunjoen taimenten geneettinen analyysi Näytteet Mika Oraluoma (Vesi-Visio osk) toimitti

Lisätiedot

Kärkihankkeet Lieksanjoella ja Pielisjoella

Kärkihankkeet Lieksanjoella ja Pielisjoella Kärkihankkeet Lieksanjoella ja Pielisjoella Niilo Valkonen Vesistökunnostusverkoston vuosiseminaari 2018 12.6.2018, Oulu Esityksen sisältö: 1. Taustaa lyhyesti 2. Pielisjoen kärkihanke (Saimaan järvilohen

Lisätiedot

Riista- ja kalatalouden tutkimuslaitoksen taimenen emokalastojen geneettinen monimuotoisuus mikrosatelliittianalyysien perusteella

Riista- ja kalatalouden tutkimuslaitoksen taimenen emokalastojen geneettinen monimuotoisuus mikrosatelliittianalyysien perusteella KALA- JA RIISTARAPORTTEJA nro 366 Teija Aho Jorma Piironen Markku Pursiainen Riista- ja kalatalouden tutkimuslaitoksen taimenen emokalastojen geneettinen monimuotoisuus mikrosatelliittianalyysien perusteella

Lisätiedot

Kuhan kalastus, kasvu ja sukukypsyys Saaristomerellä

Kuhan kalastus, kasvu ja sukukypsyys Saaristomerellä Kuhan kalastus, kasvu ja sukukypsyys Saaristomerellä Kuhaseminaari 2017 Tampere 18.5.2017 Heikki Auvinen, Luke 1 Teppo TutkijaHHeikki Auvinen Heikki Kalastus 2 Heikki Auvinen Kuhaseminaari Tampere 18.5.2017

Lisätiedot

Taimenen ja järvilohen merkintätutkimukset Ruotsalaisella

Taimenen ja järvilohen merkintätutkimukset Ruotsalaisella Taimenen ja järvilohen merkintätutkimukset Ruotsalaisella 2013-2018 Marko Puranen ja Tomi Ranta Hämeen kalatalouskeskuksen raportti nro 11/2018 2 Sisällys 1. Johdanto... 3 2. Tulokset ja tulosten tarkastelu...

Lisätiedot

Kuhan ala- ja ylämittasäätely kestävän kalastuksen välineenä

Kuhan ala- ja ylämittasäätely kestävän kalastuksen välineenä Kuhan ala- ja ylämittasäätely kestävän kalastuksen välineenä Anssi Vainikka (Itä-Suomen yliopisto, Joensuu) Hannu Huuskonen (UEF), Risto Eronen (UEF), Pekka Hyvärinen (Luke), Mikko Olin (HY), Jukka Ruuhijärvi

Lisätiedot

Kalastuksen säätely osana Inarin taimenkantojen hoitoa (sekä yleisesti Pohjolassa) Teuvo Niva RKTL, erikoistutkija, FT

Kalastuksen säätely osana Inarin taimenkantojen hoitoa (sekä yleisesti Pohjolassa) Teuvo Niva RKTL, erikoistutkija, FT Kalastuksen säätely osana Inarin taimenkantojen hoitoa (sekä yleisesti Pohjolassa) Teuvo Niva RKTL, erikoistutkija, FT Mihin tarvitaan kalastuksen säätelyä? Halutaan turvata (taloudellisesti tärkeiden)

Lisätiedot

Taimenkantojen tulevaisuus on kappalepeliä mallinnus säätelyn avuksi

Taimenkantojen tulevaisuus on kappalepeliä mallinnus säätelyn avuksi Taimenkantojen tulevaisuus on kappalepeliä mallinnus säätelyn avuksi Anssi Vainikka (Itä-Suomen Yliopisto, Joensuu) Anssi Vainikka, Lohimaa, 25.08.2017 1/21 Lyhyt oppimäärä kalatilastoja Suomessa on sisävesiä

Lisätiedot

Sisältö. Taustaa. Vaeltavan taimenen tila ja suurimmat uhat. Verkkokalastuksen säätelyn tila Keski- Suomessa

Sisältö. Taustaa. Vaeltavan taimenen tila ja suurimmat uhat. Verkkokalastuksen säätelyn tila Keski- Suomessa Ville Räihä Sisältö Taustaa Vaeltavan taimenen tila ja suurimmat uhat Verkkokalastuksen säätelyn tila Keski- Suomessa Huomioita kalastuskirjanpidosta muutamalla keskisuomalaisella taimenenkalastuskohteella

Lisätiedot

Meritaimenkannat ja niiden hoito Tornionjoella

Meritaimenkannat ja niiden hoito Tornionjoella Meritaimenkannat ja niiden hoito Tornionjoella Luonnonvarakeskus Oulu Luonnonvarakeskus Luonnonvarakeskus Lohen (ja taimenen) elinkierto 2 Esimerkki meritaimenen kutuvaelluksesta 3 4 Taimen lajina Taimenpopulaatiot

Lisätiedot

Harjunpäänjoen ja Joutsijoen lohi- ja taimenkanta 2013

Harjunpäänjoen ja Joutsijoen lohi- ja taimenkanta 2013 Harjunpäänjoen ja Joutsijoen lohi- ja taimenkanta 2013 Harjunpäänjoen koealat Koekalastukset tehtiin elokuun 2013 aikana Sähkökoekalastettujen alueiden yhteenlaskettu pinta-ala oli 2431 m 2. Koealojen

Lisätiedot

Suomenlahden taimen-ja lohitutkimuksista

Suomenlahden taimen-ja lohitutkimuksista Suomenlahden taimen-ja lohitutkimuksista Kymijoki Vantaanjoki Mustajoki Ari Saura, Luke Juhani Ahon kalastusperinneseura Helsinki, 26.11.2015 Suomen ammattikalastuksen saalis Suomenlahdella 2 1.12.2015

Lisätiedot

Kunnostetut Ingarskilanjoki ja Vantaanjoki

Kunnostetut Ingarskilanjoki ja Vantaanjoki Kunnostetut Ingarskilanjoki ja Vantaanjoki Meritaimen-seminaari, 4.2.2016, Ammattiopisto Livia, Parainen 1 Sisältö Ingarskilanjoki Vesistö numeroina Taustaa ja historiaa Elvytystyöhön yhteistyössä Tulokset

Lisätiedot

Ehdotus kalastuksen järjestämisestä Suur-Saimaan kalastusalue

Ehdotus kalastuksen järjestämisestä Suur-Saimaan kalastusalue Ehdotus kalastuksen järjestämisestä Suur-Saimaan kalastusalue Sisällysluettelo 1. UHANALAISET KOHDELAJIT...4 1.1 Harjus...4 1.2 Järvilohi...4 1.3 Järvitaimen...4 1.4 Saimaannieriä...4 2. TOIMENPITEET...5

Lisätiedot

Pohjoiskarjalainen kalatie

Pohjoiskarjalainen kalatie Pohjoiskarjalainen kalatie Järvilohi on ollut Vuoksen vesistössä jo vuosikymmenet viljelyn varassa ja luontaista lisääntymistä ei juurikaan tapahdu. Järvilohi (ts. Pohjois-Karjalan ELY-keskus) voitti voimayhtiöitä

Lisätiedot

Koulutus kalojen lääkinnästä 5.2.2015 Hanna Kuukka-Anttila Eläinten terveys ja hyvinvointi yksikkö, Evira. Kalanviljely Suomessa

Koulutus kalojen lääkinnästä 5.2.2015 Hanna Kuukka-Anttila Eläinten terveys ja hyvinvointi yksikkö, Evira. Kalanviljely Suomessa Koulutus kalojen lääkinnästä 5.2.2015 Hanna Kuukka-Anttila Eläinten terveys ja hyvinvointi yksikkö, Evira Kalanviljely Suomessa Vesiviljely maailmassa Kalojen, nilviäisten, äyriäisten ja vesikasvien kasvatusta

Lisätiedot

Kestävän kalastuksen ja luontomatkailun kehi:ämishanke 2011 2014

Kestävän kalastuksen ja luontomatkailun kehi:ämishanke 2011 2014 Kestävän kalastuksen ja luontomatkailun kehi:ämishanke 2011 2014 Etelä- Savon ELY- keskuksen kalatalousryhmän hallinnoima EU:n osarahoi9einen hanke (50 %). Hankkeen kustannusarvio on noin 600 000 euroa.

Lisätiedot

Järvitaimen ja lohi troolisaaliissa. Timo Turunen, Pohjois-Karjalan ELY-keskus

Järvitaimen ja lohi troolisaaliissa. Timo Turunen, Pohjois-Karjalan ELY-keskus Järvitaimen ja lohi troolisaaliissa Timo Turunen, Pohjois-Karjalan ELY-keskus 5.11.2012 2 Järvitaimenen ja -lohen määrä troolisaaliissa (1/2) Pielinen v. 1988: 3,5 kpl /vetotunti (JT ja JL yhteensä) Höytiäinen,

Lisätiedot

Kaunis pieni saalistaimen

Kaunis pieni saalistaimen Kaunis pieni saalistaimen Kaunis pieni saalistaimen Mutta riittääkö tuo saalis houkuttelemaan alueelle matkailijoita? Millaisin toimin Kainuun kalavesiä saataisiin houkuttelevammiksi? Pienestä joesta tuli

Lisätiedot

100-v juhlaseminaari, UKK-instituutti Tampere 2.4.2014. Kalatalousneuvoja Ismo Kolari Pirkanmaan Kalatalouskeskus

100-v juhlaseminaari, UKK-instituutti Tampere 2.4.2014. Kalatalousneuvoja Ismo Kolari Pirkanmaan Kalatalouskeskus 100-v juhlaseminaari, UKK-instituutti Tampere 2.4.2014 Kalatalousneuvoja Ismo Kolari Pirkanmaan Kalatalouskeskus Evon kalanviljelylaitos Lammi 1892 Myllypuron kalanviljelylaitos Ylöjärvi 1916 toiminta

Lisätiedot

Ehdotus kalastuksen järjestämisestä Pielisen kalastusalue

Ehdotus kalastuksen järjestämisestä Pielisen kalastusalue Ehdotus kalastuksen järjestämisestä Pielisen kalastusalue Sisällysluettelo 1. UHANALAISET KOHDELAJIT...4 1.1 Harjus...4 1.2 Järvilohi...4 1.3 Järvitaimen...4 2. TOIMENPITEET...5 2.1 Rasvaevällisten vapauttaminen...5

Lisätiedot

Ehdotus kalastuksen järjestämisestä Pihlajaveden kalastusalue

Ehdotus kalastuksen järjestämisestä Pihlajaveden kalastusalue Ehdotus kalastuksen järjestämisestä Pihlajaveden kalastusalue Sisällysluettelo 1. UHANALAISET KOHDELAJIT... 4 1.1 Harjus... 4 1.2 Järvilohi... 4 1.3 Järvitaimen... 4 1.4 Saimaannieriä... 4 2. TOIMENPITEET...

Lisätiedot

Kuhakannan hoito ja kalastuksen säätely Kokemuksia Oulujärveltä

Kuhakannan hoito ja kalastuksen säätely Kokemuksia Oulujärveltä Kuhakannan hoito ja kalastuksen säätely Kokemuksia Oulujärveltä Lapin 13. kalatalouspäivät, Rovaniemi 1.11.216 Pekka Hyvärinen Luonnonvarakeskus, Kainuun kalantutkimusasema www.luke.fi www.kfrs.fi Oulujärven

Lisätiedot

TIEDOTE ORAVAREITIN MELOJILLE!

TIEDOTE ORAVAREITIN MELOJILLE! TIEDOTE ORAVAREITIN MELOJILLE! KOSKIEN ENNALLISTAMISHANKE ETENEE, TAVOITTEENA PALAUTTAA JÄRVITAIMENEN LUONTAINEN LISÄÄNTYMINEN. KOSKIEN MELOTTAVUUS LÄHES ENNALLAAN MUTTA MELONTAVÄYLÄT OVAT MUUTTUNEET.

Lisätiedot

Istuta oma järvitaimen sponsoritaimen mainostila webiin

Istuta oma järvitaimen sponsoritaimen mainostila webiin Istuta oma järvitaimen sponsoritaimen mainostila webiin Naruska-Kullajärven kalastusyhtymä on mökkiläisten perustama yhteisö Itä-Lapissa, Sallan kunnan pohjoisosassa sijaitsevalla Naruskajärvellä. Kalastusyhtymä

Lisätiedot

Luonnonvaraisesti lisääntyvät siikakannat

Luonnonvaraisesti lisääntyvät siikakannat Luonnonvaraisesti lisääntyvät siikakannat Ari Leskelä ja Teuvo Niva RKTL Onko meillä uhanalaisia siikakantoja? Siika on yleisimpiä kalalajejamme ja hyvin monimuotoinen samassa vesistössä voi elää useita

Lisätiedot

Saimaan lohikalojen kestävän kalastuksen edistäminen Kyselytutkimus Loppuraportin tiivistelmä

Saimaan lohikalojen kestävän kalastuksen edistäminen Kyselytutkimus Loppuraportin tiivistelmä Saimaan lohikalojen kestävän kalastuksen edistäminen Kyselytutkimus 0 Loppuraportin tiivistelmä . Kyselytutkimuksen tausta ja tavoitteet Pohjois-Karjalan ELY-keskus kumppaneinaan muut Itä-Suomen ELY-keskukset

Lisätiedot

Kokemäenjoen vesistön vesiensuojeluyhdistys ry

Kokemäenjoen vesistön vesiensuojeluyhdistys ry Kalastusaluepäivä, Jämsä 15.12.2016 Heikki Holsti DNA ja taimenkantojen hoito Kokemäenjoen vesistön vesiensuojeluyhdistys ry EKOLOGIAN KERTAUSTA GEENIT JA PERIMÄN VAIHTELU OVAT AVAIN SELVIYTYMISELLE MUUTTUVISSA

Lisätiedot

Vieläkö on villejä järvitaimenia?

Vieläkö on villejä järvitaimenia? Jyväskylän riistan ja kalantutkimus Vieläkö on villejä järvitaimenia? Keski-Suomen järvitaimen hankkeen raportti vuodelta 2007 Jukka Syrjänen ja Pentti Valkeajärvi Riista- ja kalatalouden tutkimuslaitos

Lisätiedot

PÄÄTÖS 1 (5) Annettu julkipanon jälkeen 20.10.2004 1650/5715/04

PÄÄTÖS 1 (5) Annettu julkipanon jälkeen 20.10.2004 1650/5715/04 PÄÄTÖS 1 (5) Annettu julkipanon jälkeen 20.10.2004 1650/5715/04 Viite Kalastuslain (286/82) 119 ASIA POHJOIS-KARJALAN LOHI- JA SIIKAPITOISET VESISTÖT TAUSTAA Yleiskalastusoikeudet Onginta ja pilkintä ovat

Lisätiedot

Ehdotus kalastuksen järjestämisestä Keski-Karjalan kalastusalue

Ehdotus kalastuksen järjestämisestä Keski-Karjalan kalastusalue Ehdotus kalastuksen järjestämisestä Keski-Karjalan kalastusalue Sisällysluettelo 1. UHANALAISET KOHDELAJIT... 4 1.1 Harjus... 4 1.2 Järvilohi... 4 1.3 Järvitaimen... 4 2. TOIMENPITEET... 5 2.1 Rasvaevällisten

Lisätiedot

Ehdotus kalastuksen järjestämisestä Louhi-Yöveden kalastusalue

Ehdotus kalastuksen järjestämisestä Louhi-Yöveden kalastusalue Ehdotus kalastuksen järjestämisestä Louhi-Yöveden kalastusalue Sisällysluettelo 1. UHANALAISET KOHDELAJIT...4 1.1 Harjus...4 1.2 Järvilohi...4 1.3 Järvitaimen...4 1.4 Saimaannieriä...4 2. TOIMENPITEET...5

Lisätiedot

VASTAUS 2a: Ruusukaijasten väri

VASTAUS 2a: Ruusukaijasten väri VASTAUS 2a: Ruusukaijasten väri Merkitään: ZK= Vihreän värin aiheuttava dominoiva alleeli Zk= keltaisen värin aiheuttava resessiivinen alleeli W= W-kromosomi Keltaisen koiraan perimä ZkZk, vihreän naaraan

Lisätiedot

Päijänteen ja sen latvavesien taimenkantojen geneettiset resurssit

Päijänteen ja sen latvavesien taimenkantojen geneettiset resurssit Luonnonvara- ja biotalouden tutkimus 6/2018 Päijänteen ja sen latvavesien taimenkantojen geneettiset resurssit Marja-Liisa Koljonen, Jukka Tapani Syrjänen, Jarmo Koskiniemi ja Petri Heinimaa Päijänteen

Lisätiedot

Pielisen alueen virtavedet järvitaimenen ja järvilohen näkökulmasta

Pielisen alueen virtavedet järvitaimenen ja järvilohen näkökulmasta Pielisen alueen virtavedet järvitaimenen ja järvilohen näkökulmasta TOIMENPIDESELVITYS Future Missions Oy 2015 - EU investoi kestävään kalatalouteen - Future Missions Oy:n julkaisu 1:2015 Pielisen alueen

Lisätiedot

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 EU:n osarahoitteinen hanke (50%). Hankkeen kustannusarvio on noin 620 000 euroa. Hankkeella on rahoittajia 39 kpl. Neljä vesistöaluetta

Lisätiedot

Mitä tiedetään Oulujärven kuhasta tänään?

Mitä tiedetään Oulujärven kuhasta tänään? Mitä tiedetään Oulujärven kuhasta tänään? Kaukametsän kongressi ja kulttuurikeskus, Kajaani 15.4.215 Pekka Hyvärinen Luonnonvarakeskus, Kainuun kalantutkimusasema www.luke.fi www.kfrs.fi Oulujärven kuhan

Lisätiedot

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014

Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 Kestävän kalastuksen ja luontomatkailun kehittämishanke 2011 2014 EU:n osarahoitteinen hanke (50%). Hankkeen kustannusarvio on noin 620 000 euroa. Hankkeella on rahoittajia 39 kpl. Neljä vesistöaluetta

Lisätiedot

Ehdotus kalastuksen järjestämisestä Puumalan kalastusalue

Ehdotus kalastuksen järjestämisestä Puumalan kalastusalue Ehdotus kalastuksen järjestämisestä Puumalan kalastusalue Sisällysluettelo 1. UHANALAISET KOHDELAJIT...4 1.1 Harjus...4 1.2 Järvilohi...4 1.3 Järvitaimen...4 1.4 Saimaannieriä...4 2. TOIMENPITEET...5 2.1

Lisätiedot

Kuhan kalastuksensäätelyn sovittaminen paikallisiin olosuhteisiin

Kuhan kalastuksensäätelyn sovittaminen paikallisiin olosuhteisiin Kuhan kalastuksensäätelyn sovittaminen paikallisiin olosuhteisiin Esimerkkinä Höytiäinen Kalastusaluepäivät, Huhmari 16.3.2018 Yliopistotutkija Hannu Huuskonen, Itä-Suomen yliopisto, Ympäristö- ja biotieteiden

Lisätiedot

Pielisen Järvilohi ja Taimen 2008 2010 -hanke. Smolttipyyntiraportti 24.8.2009 Timo Hartikainen

Pielisen Järvilohi ja Taimen 2008 2010 -hanke. Smolttipyyntiraportti 24.8.2009 Timo Hartikainen Pielisen Järvilohi ja Taimen 2008 2010 -hanke Smolttipyyntiraportti 24.8.2009 Timo Hartikainen SISÄLLYSLUETTELO: Sisältö 1. Johdanto... 2 2. Kerätty aineisto... 2 3. Smolttipyynti Lieksanjoella 25.5.-28.6

Lisätiedot

Heinävedenreitin kestävän kalastuksen ohjelma ja kalataloudellinen kehittämissuunnitelma

Heinävedenreitin kestävän kalastuksen ohjelma ja kalataloudellinen kehittämissuunnitelma RAPORTTEJA 80 2014 Heinävedenreitin kestävän kalastuksen ohjelma ja kalataloudellinen kehittämissuunnitelma JOONAS RAJALA TEEMU HENTINEN Heinävedenreitin kestävän kalastuksen ohjelma ja kalataloudellinen

Lisätiedot

Ehdotus kalastuksen järjestämisestä Haukiveden kalastusalue

Ehdotus kalastuksen järjestämisestä Haukiveden kalastusalue Ehdotus kalastuksen järjestämisestä Haukiveden kalastusalue Sisällysluettelo 1. UHANALAISET KOHDELAJIT...4 1.1 Harjus...4 1.2 Järvilohi...4 1.3 Järvitaimen...4 1.4 Saimaannieriä...4 2. TOIMENPITEET...5

Lisätiedot